Файловый менеджер - Редактировать - /var/www/html/gawk.zip
Ðазад
PK ! �� �- - examples/misc/sample.csvnu �[��� p,"q,r",s p,"q""r",s p,"q,""r",s p,"",s p,,s PK ! �V�P� � examples/misc/findpat.awknu �[��� { if ($1 == "FIND") regex = $2 else { where = match($0, regex) if (where != 0) print "Match of", regex, "found at", where, "in", $0 } } PK ! to&u u examples/misc/arraymax.awknu �[��� { if ($1 > max) max = $1 arr[$1] = $0 } END { for (x = 1; x <= max; x++) print arr[x] } PK ! ��1� examples/misc/test-csv.awknu �[��� BEGIN { fp[0] = "([^,]+)|(\"[^\"]+\")" fp[1] = "([^,]*)|(\"[^\"]+\")" fp[2] = "([^,]*)|(\"([^\"]|\"\")+\")" FPAT = fp[fpat+0] } { print "<" $0 ">" printf("NF = %s ", NF) for (i = 1; i <= NF; i++) { printf("<%s>", $i) } print "" } PK ! C��� � examples/misc/simple-csv.awknu �[��� BEGIN { FPAT = "([^,]+)|(\"[^\"]+\")" } { print "NF = ", NF for (i = 1; i <= NF; i++) { printf("$%d = <%s>\n", i, $i) } } PK ! G���H H examples/misc/addresses.csvnu �[��� Robbins,Arnold,"1234 A Pretty Street, NE",MyTown,MyState,12345-6789,USA PK ! i8� examples/misc/arraymax.datanu �[��� 5 I am the Five man 2 Who are you? The new number two! 4 . . . And four on the floor 1 Who is number one? 3 I three you. PK ! �h�� � examples/misc/findpat.datanu �[��� FIND ru+n My program runs but not very quickly FIND Melvin JF+KM This line is property of Reality Engineering Co. Melvin was here. PK ! ��Ò? ? examples/network/panic.awknu �[��� BEGIN { RS = ORS = "\r\n" if (MyPort == 0) MyPort = 8080 HttpService = "/inet/tcp/" MyPort "/0/0" Hello = "<HTML><HEAD><TITLE>Out Of Service</TITLE>" \ "</HEAD><BODY><H1>" \ "This site is temporarily out of service." \ "</H1></BODY></HTML>" Len = length(Hello) + length(ORS) while ("awk" != "complex") { print "HTTP/1.0 200 OK" |& HttpService print "Content-Length: " Len ORS |& HttpService print Hello |& HttpService while ((HttpService |& getline) > 0) continue; close(HttpService) } } PK ! �l��� � examples/network/webgrab.awknu �[��� BEGIN { RS = "https?://[#%&\\+\\-\\./0-9\\:;\\?A-Z_a-z\\~]*" } RT != "" { command = ("gawk -v Proxy=MyProxy -f geturl.awk " RT \ " > doc" NR ".html") print command } PK ! ^�1� � examples/network/stoxdata.txtnu �[��� Date,Open,High,Low,Close,Volume 9-Oct-00,22.75,22.75,21.375,22.375,7888500 6-Oct-00,23.8125,24.9375,21.5625,22,10701100 5-Oct-00,24.4375,24.625,23.125,23.50,5810300 PK ! � �N N examples/network/testserv.awknu �[��� BEGIN { CGI_setup("GET", "http://www.gnu.org/cgi-bin/foo?p1=stuff&p2=stuff%26junk" \ "&percent=a %25 sign", "1.0") for (i in MENU) printf "MENU[\"%s\"] = %s\n", i, MENU[i] for (i in PARAM) printf "PARAM[\"%s\"] = %s\n", i, PARAM[i] for (i in GETARG) printf "GETARG[\"%s\"] = %s\n", i, GETARG[i] } PK ! ~�$�� � examples/network/hello-serv.awknu �[��� BEGIN { RS = ORS = "\r\n" HttpService = "/inet/tcp/8080/0/0" Hello = "<HTML><HEAD>" \ "<TITLE>A Famous Greeting</TITLE></HEAD>" \ "<BODY><H1>Hello, world</H1></BODY></HTML>" Len = length(Hello) + length(ORS) print "HTTP/1.0 200 OK" |& HttpService print "Content-Length: " Len ORS |& HttpService print Hello |& HttpService while ((HttpService |& getline) > 0) continue; close(HttpService) } PK ! �9#�� � examples/network/protbase.awknu �[��� { request = request "\n" $0 } END { BLASTService = "/inet/tcp/0/www.ncbi.nlm.nih.gov/80" printf "POST /cgi-bin/BLAST/nph-blast_report HTTP/1.0\n" |& BLASTService printf "Content-Length: " length(request) "\n\n" |& BLASTService printf request |& BLASTService while ((BLASTService |& getline) > 0) print $0 close(BLASTService) } PK ! ���� � ! examples/network/protbase.requestnu �[��� PROGRAM blastn DATALIB month EXPECT 0.75 BEGIN >GAWK310 the gawking gene GNU AWK tgcttggctgaggagccataggacgagagcttcctggtgaagtgtgtttcttgaaatcat caccaccatggacagcaaa PK ! FG� examples/network/PostAgent.shnu �[��� #!/bin/sh MobAg=/tmp/MobileAgent.$$ # direct script to mobile agent file cat > $MobAg # execute agent concurrently gawk -f $MobAg $MobAg > /dev/null & # HTTP header, terminator and body gawk 'BEGIN { print "\r\nAgent started" }' rm $MobAg # delete script file of agent PK ! w�5�_ _ examples/network/maze.awknu �[��� function SetUpServer() { TopHeader = "<HTML><title>Walk through a maze</title>" TopDoc = "\ <h2>Please choose one of the following actions:</h2>\ <UL>\ <LI><A HREF=" MyPrefix "/AboutServer>About this server</A>\ <LI><A HREF=" MyPrefix "/VRMLtest>Watch a simple VRML scene</A>\ </UL>" TopFooter = "</HTML>" srand() } function HandleGET() { if (MENU[2] == "AboutServer") { Document = "If your browser has a VRML 2 plugin,\ this server shows you a simple VRML scene." } else if (MENU[2] == "VRMLtest") { XSIZE = YSIZE = 11 # initially, everything is wall for (y = 0; y < YSIZE; y++) for (x = 0; x < XSIZE; x++) Maze[x, y] = "#" delete Maze[0, 1] # entry is not wall delete Maze[XSIZE-1, YSIZE-2] # exit is not wall MakeMaze(1, 1) Document = "\ #VRML V2.0 utf8\n\ Group {\n\ children [\n\ PointLight {\n\ ambientIntensity 0.2\n\ color 0.7 0.7 0.7\n\ location 0.0 8.0 10.0\n\ }\n\ DEF B1 Background {\n\ skyColor [0 0 0, 1.0 1.0 1.0 ]\n\ skyAngle 1.6\n\ groundColor [1 1 1, 0.8 0.8 0.8, 0.2 0.2 0.2 ]\n\ groundAngle [ 1.2 1.57 ]\n\ }\n\ DEF Wall Shape {\n\ geometry Box {size 1 1 1}\n\ appearance Appearance { material Material { diffuseColor 0 0 1 } }\n\ }\n\ DEF Entry Viewpoint {\n\ position 0.5 1.0 5.0\n\ orientation 0.0 0.0 -1.0 0.52\n\ }\n" for (i in Maze) { split(i, t, SUBSEP) Document = Document " Transform { translation " Document = Document t[1] " 0 -" t[2] " children USE Wall }\n" } Document = Document " ] # end of group for world\n}" Reason = "OK" ORS "Content-type: model/vrml" Header = Footer = "" } } function MakeMaze(x, y) { delete Maze[x, y] # here we are, we have no wall here p = 0 # count unvisited fields in all directions if (x-2 SUBSEP y in Maze) d[p++] = "-x" if (x SUBSEP y-2 in Maze) d[p++] = "-y" if (x+2 SUBSEP y in Maze) d[p++] = "+x" if (x SUBSEP y+2 in Maze) d[p++] = "+y" if (p>0) { # if there are unvisited fields, go there p = int(p*rand()) # choose one unvisited field at random if (d[p] == "-x") { delete Maze[x - 1, y]; MakeMaze(x - 2, y) } else if (d[p] == "-y") { delete Maze[x, y - 1]; MakeMaze(x, y - 2) } else if (d[p] == "+x") { delete Maze[x + 1, y]; MakeMaze(x + 2, y) } else if (d[p] == "+y") { delete Maze[x, y + 1]; MakeMaze(x, y + 2) } # we are back from recursion MakeMaze(x, y); # try again while there are unvisited fields } } PK ! _9J� � examples/network/remconf.awknu �[��� function SetUpServer() { TopHeader = "<HTML><title>Remote Configuration</title>" TopDoc = "<BODY>\ <h2>Please choose one of the following actions:</h2>\ <UL>\ <LI><A HREF=" MyPrefix "/AboutServer>About this server</A></LI>\ <LI><A HREF=" MyPrefix "/ReadConfig>Read Configuration</A></LI>\ <LI><A HREF=" MyPrefix "/CheckConfig>Check Configuration</A></LI>\ <LI><A HREF=" MyPrefix "/ChangeConfig>Change Configuration</A></LI>\ <LI><A HREF=" MyPrefix "/SaveConfig>Save Configuration</A></LI>\ </UL>" TopFooter = "</BODY></HTML>" if (ConfigFile == "") ConfigFile = "config.asc" } function HandleGET() { if (MENU[2] == "AboutServer") { Document = "This is a GUI for remote configuration of an\ embedded system. It is is implemented as one GAWK script." } else if (MENU[2] == "ReadConfig") { RS = "\n" while ((getline < ConfigFile) > 0) config[$1] = $2; close(ConfigFile) RS = "\r\n" Document = "Configuration has been read." } else if (MENU[2] == "CheckConfig") { Document = "<TABLE BORDER=1 CELLPADDING=5>" for (i in config) Document = Document "<TR><TD>" i "</TD>" \ "<TD>" config[i] "</TD></TR>" Document = Document "</TABLE>" } else if (MENU[2] == "ChangeConfig") { if ("Param" in GETARG) { # any parameter to set? if (GETARG["Param"] in config) { # is parameter valid? config[GETARG["Param"]] = GETARG["Value"] Document = (GETARG["Param"] " = " GETARG["Value"] ".") } else { Document = "Parameter <b>" GETARG["Param"] "</b> is invalid." } } else { Document = "<FORM method=GET><h4>Change one parameter</h4>\ <TABLE BORDER CELLPADDING=5>\ <TR><TD>Parameter</TD><TD>Value</TD></TR>\ <TR><TD><input type=text name=Param value=\"\" size=20></TD>\ <TD><input type=text name=Value value=\"\" size=40></TD>\ </TR></TABLE><input type=submit value=\"Set\"></FORM>" } } else if (MENU[2] == "SaveConfig") { for (i in config) printf("%s %s\n", i, config[i]) > ConfigFile close(ConfigFile) Document = "Configuration has been saved." } } PK ! v�>� examples/network/stoxpred.awknu �[��� BEGIN { Init() ReadQuotes() CleanUp() Prediction() Report() SendMail() } function Init() { if (ARGC != 1) { print "STOXPRED - daily stock share prediction" print "IN:\n no parameters, nothing on stdin" print "PARAM:\n -v Proxy=MyProxy -v ProxyPort=80" print "OUT:\n commented predictions as email" print "JK 09.10.2000" exit } # Remember ticker symbols from Dow Jones Industrial Index StockCount = split("AA GE JNJ MSFT AXP GM JPM PG BA HD KO \ SBC C HON MCD T CAT HWP MMM UTX DD IBM MO WMT DIS INTC \ MRK XOM EK IP", name); # Remember the current date as the end of the time series day = strftime("%d") month = strftime("%m") year = strftime("%Y") if (Proxy == "") Proxy = "chart.yahoo.com" if (ProxyPort == 0) ProxyPort = 80 YahooData = "/inet/tcp/0/" Proxy "/" ProxyPort } function ReadQuotes() { # Retrieve historical data for each ticker symbol FS = "," for (stock = 1; stock <= StockCount; stock++) { URL = "http://chart.yahoo.com/table.csv?s=" name[stock] \ "&a=" month "&b=" day "&c=" year-1 \ "&d=" month "&e=" day "&f=" year \ "g=d&q=q&y=0&z=" name[stock] "&x=.csv" printf("GET " URL " HTTP/1.0\r\n\r\n") |& YahooData while ((YahooData |& getline) > 0) { if (NF == 6 && $1 ~ /Jan|Feb|Mar|Apr|May|Jun|Jul|Aug|Sep|Oct|Nov|Dec/) { if (stock == 1) days[++daycount] = $1; quote[$1, stock] = $5 } } close(YahooData) } FS = " " } function CleanUp() { # clean up time series; eliminate incomplete data sets for (d = 1; d <= daycount; d++) { for (stock = 1; stock <= StockCount; stock++) if (! ((days[d], stock) in quote)) stock = StockCount + 10 if (stock > StockCount + 1) continue datacount++ for (stock = 1; stock <= StockCount; stock++) data[datacount, stock] = int(0.5 + quote[days[d], stock]) } delete quote delete days } function Prediction() { # Predict each ticker symbol by prolonging yesterday's trend for (stock = 1; stock <= StockCount; stock++) { if (data[1, stock] > data[2, stock]) { predict[stock] = "up" } else if (data[1, stock] < data[2, stock]) { predict[stock] = "down" } else { predict[stock] = "neutral" } if ((data[1, stock] > data[2, stock]) && (data[2, stock] > data[3, stock])) hot[stock] = 1 if ((data[1, stock] < data[2, stock]) && (data[2, stock] < data[3, stock])) avoid[stock] = 1 } # Do a plausibility check: how many predictions proved correct? for (s = 1; s <= StockCount; s++) { for (d = 1; d <= datacount-2; d++) { if (data[d+1, s] > data[d+2, s]) { UpCount++ } else if (data[d+1, s] < data[d+2, s]) { DownCount++ } else { NeutralCount++ } if (((data[d, s] > data[d+1, s]) && (data[d+1, s] > data[d+2, s])) || ((data[d, s] < data[d+1, s]) && (data[d+1, s] < data[d+2, s])) || ((data[d, s] == data[d+1, s]) && (data[d+1, s] == data[d+2, s]))) CorrectCount++ } } } function Report() { # Generate report report = "\nThis is your daily " report = report "stock market report for "strftime("%A, %B %d, %Y")".\n" report = report "Here are the predictions for today:\n\n" for (stock = 1; stock <= StockCount; stock++) report = report "\t" name[stock] "\t" predict[stock] "\n" for (stock in hot) { if (HotCount++ == 0) report = report "\nThe most promising shares for today are these:\n\n" report = report "\t" name[stock] "\t\thttp://biz.yahoo.com/n/" \ tolower(substr(name[stock], 1, 1)) "/" tolower(name[stock]) ".html\n" } for (stock in avoid) { if (AvoidCount++ == 0) report = report "\nThe stock shares to avoid today are these:\n\n" report = report "\t" name[stock] "\t\thttp://biz.yahoo.com/n/" \ tolower(substr(name[stock], 1, 1)) "/" tolower(name[stock]) ".html\n" } report = report "\nThis sums up to " HotCount+0 " winners and " AvoidCount+0 report = report " losers. When using this kind\nof prediction scheme for" report = report " the 12 months which lie behind us,\nwe get " UpCount report = report " 'ups' and " DownCount " 'downs' and " NeutralCount report = report " 'neutrals'. Of all\nthese " UpCount+DownCount+NeutralCount report = report " predictions " CorrectCount " proved correct next day.\n" report = report "A success rate of "\ int(100*CorrectCount/(UpCount+DownCount+NeutralCount)) "%.\n" report = report "Random choice would have produced a 33% success rate.\n" report = report "Disclaimer: Like every other prediction of the stock\n" report = report "market, this report is, of course, complete nonsense.\n" report = report "If you are stupid enough to believe these predictions\n" report = report "you should visit a doctor who can treat your ailment." } function SendMail() { # send report to customers customer["uncle.scrooge@ducktown.gov"] = "Uncle Scrooge" customer["more@utopia.org" ] = "Sir Thomas More" customer["spinoza@denhaag.nl" ] = "Baruch de Spinoza" customer["marx@highgate.uk" ] = "Karl Marx" customer["keynes@the.long.run" ] = "John Maynard Keynes" customer["bierce@devil.hell.org" ] = "Ambrose Bierce" customer["laplace@paris.fr" ] = "Pierre Simon de Laplace" for (c in customer) { MailPipe = "mail -s 'Daily Stock Prediction Newsletter'" c print "Good morning " customer[c] "," | MailPipe print report "\n.\n" | MailPipe close(MailPipe) } } PK ! �����' �' examples/network/eliza.awknu �[��� function SetUpServer() { SetUpEliza() TopHeader = \ "<HTML><title>An HTTP-based System with GAWK</title>\ <HEAD><META HTTP-EQUIV=\"Content-Type\"\ CONTENT=\"text/html; charset=iso-8859-1\"></HEAD>\ <BODY BGCOLOR=\"#ffffff\" TEXT=\"#000000\"\ LINK=\"#0000ff\" VLINK=\"#0000ff\"\ ALINK=\"#0000ff\"> <A NAME=\"top\">" TopDoc = "\ <h2>Please choose one of the following actions:</h2>\ <UL>\ <LI>\ <A HREF=" MyPrefix "/AboutServer>About this server</A>\ </LI><LI>\ <A HREF=" MyPrefix "/AboutELIZA>About Eliza</A></LI>\ <LI>\ <A HREF=" MyPrefix \ "/StartELIZA>Start talking to Eliza</A></LI></UL>" TopFooter = "</BODY></HTML>" } function HandleGET() { # A real HTTP server would treat some parts of the URI as a file name. # We take parts of the URI as menu choices and go on accordingly. if (MENU[2] == "AboutServer") { Document = "This is not a CGI script.\ This is an httpd, an HTML file, and a CGI script all \ in one GAWK script. It needs no separate www-server, \ no installation, and no root privileges.\ <p>To run it, do this:</p><ul>\ <li> start this script with \"gawk -f httpserver.awk\",</li>\ <li> and on the same host let your www browser open location\ \"http://localhost:8080\"</li>\ </ul>\<p>\ Details of HTTP come from:</p><ul>\ <li>Hethmon: Illustrated Guide to HTTP</p>\ <li>RFC 2068</li></ul><p>JK 14.9.1997</p>" } else if (MENU[2] == "AboutELIZA") { Document = "This is an implementation of the famous ELIZA\ program by Joseph Weizenbaum. It is written in GAWK and\ uses an HTML GUI." } else if (MENU[2] == "StartELIZA") { gsub(/\+/, " ", GETARG["YouSay"]) # Here we also have to substitute coded special characters Document = "<form method=GET>" \ "<h3>" ElizaSays(GETARG["YouSay"]) "</h3>\ <p><input type=text name=YouSay value=\"\" size=60>\ <br><input type=submit value=\"Tell her about it\"></p></form>" } } function ElizaSays(YouSay) { if (YouSay == "") { cost = 0 answer = "HI, IM ELIZA, TELL ME YOUR PROBLEM" } else { q = toupper(YouSay) gsub("'", "", q) if (q == qold) { answer = "PLEASE DONT REPEAT YOURSELF !" } else { if (index(q, "SHUT UP") > 0) { answer = "WELL, PLEASE PAY YOUR BILL. ITS EXACTLY ... $"\ int(100*rand()+30+cost/100) } else { qold = q w = "-" # no keyword recognized yet for (i in k) { # search for keywords if (index(q, i) > 0) { w = i break } } if (w == "-") { # no keyword, take old subject w = wold subj = subjold } else { # find subject subj = substr(q, index(q, w) + length(w)+1) wold = w subjold = subj # remember keyword and subject } for (i in conj) gsub(i, conj[i], q) # conjugation # from all answers to this keyword, select one randomly answer = r[indices[int(split(k[w], indices) * rand()) + 1]] # insert subject into answer gsub("_", subj, answer) } } } cost += length(answer) # for later payment : 1 cent per character return answer } function SetUpEliza() { srand() wold = "-" subjold = " " # table for conjugation conj[" ARE " ] = " AM " conj["WERE " ] = "WAS " conj[" YOU " ] = " I " conj["YOUR " ] = "MY " conj[" IVE " ] =\ conj[" I HAVE " ] = " YOU HAVE " conj[" YOUVE " ] =\ conj[" YOU HAVE "] = " I HAVE " conj[" IM " ] =\ conj[" I AM " ] = " YOU ARE " conj[" YOURE " ] =\ conj[" YOU ARE " ] = " I AM " # table of all answers r[1] = "DONT YOU BELIEVE THAT I CAN _" r[2] = "PERHAPS YOU WOULD LIKE TO BE ABLE TO _ ?" r[3] = "YOU WANT ME TO BE ABLE TO _ ?" r[4] = "PERHAPS YOU DONT WANT TO _ " r[5] = "DO YOU WANT TO BE ABLE TO _ ?" r[6] = "WHAT MAKES YOU THINK I AM _ ?" r[7] = "DOES IT PLEASE YOU TO BELIEVE I AM _ ?" r[8] = "PERHAPS YOU WOULD LIKE TO BE _ ?" r[9] = "DO YOU SOMETIMES WISH YOU WERE _ ?" r[10] = "DONT YOU REALLY _ ?" r[11] = "WHY DONT YOU _ ?" r[12] = "DO YOU WISH TO BE ABLE TO _ ?" r[13] = "DOES THAT TROUBLE YOU ?" r[14] = "TELL ME MORE ABOUT SUCH FEELINGS" r[15] = "DO YOU OFTEN FEEL _ ?" r[16] = "DO YOU ENJOY FEELING _ ?" r[17] = "DO YOU REALLY BELIEVE I DONT _ ?" r[18] = "PERHAPS IN GOOD TIME I WILL _ " r[19] = "DO YOU WANT ME TO _ ?" r[20] = "DO YOU THINK YOU SHOULD BE ABLE TO _ ?" r[21] = "WHY CANT YOU _ ?" r[22] = "WHY ARE YOU INTERESTED IN WHETHER OR NOT I AM _ ?" r[23] = "WOULD YOU PREFER IF I WERE NOT _ ?" r[24] = "PERHAPS IN YOUR FANTASIES I AM _ " r[25] = "HOW DO YOU KNOW YOU CANT _ ?" r[26] = "HAVE YOU TRIED ?" r[27] = "PERHAPS YOU CAN NOW _ " r[28] = "DID YOU COME TO ME BECAUSE YOU ARE _ ?" r[29] = "HOW LONG HAVE YOU BEEN _ ?" r[30] = "DO YOU BELIEVE ITS NORMAL TO BE _ ?" r[31] = "DO YOU ENJOY BEING _ ?" r[32] = "WE WERE DISCUSSING YOU -- NOT ME" r[33] = "Oh, I _" r[34] = "YOU'RE NOT REALLY TALKING ABOUT ME, ARE YOU ?" r[35] = "WHAT WOULD IT MEAN TO YOU, IF YOU GOT _ ?" r[36] = "WHY DO YOU WANT _ ?" r[37] = "SUPPOSE YOU SOON GOT _" r[38] = "WHAT IF YOU NEVER GOT _ ?" r[39] = "I SOMETIMES ALSO WANT _" r[40] = "WHY DO YOU ASK ?" r[41] = "DOES THAT QUESTION INTEREST YOU ?" r[42] = "WHAT ANSWER WOULD PLEASE YOU THE MOST ?" r[43] = "WHAT DO YOU THINK ?" r[44] = "ARE SUCH QUESTIONS IN YOUR MIND OFTEN ?" r[45] = "WHAT IS IT THAT YOU REALLY WANT TO KNOW ?" r[46] = "HAVE YOU ASKED ANYONE ELSE ?" r[47] = "HAVE YOU ASKED SUCH QUESTIONS BEFORE ?" r[48] = "WHAT ELSE COMES TO MIND WHEN YOU ASK THAT ?" r[49] = "NAMES DON'T INTEREST ME" r[50] = "I DONT CARE ABOUT NAMES -- PLEASE GO ON" r[51] = "IS THAT THE REAL REASON ?" r[52] = "DONT ANY OTHER REASONS COME TO MIND ?" r[53] = "DOES THAT REASON EXPLAIN ANYTHING ELSE ?" r[54] = "WHAT OTHER REASONS MIGHT THERE BE ?" r[55] = "PLEASE DON'T APOLOGIZE !" r[56] = "APOLOGIES ARE NOT NECESSARY" r[57] = "WHAT FEELINGS DO YOU HAVE WHEN YOU APOLOGIZE ?" r[58] = "DON'T BE SO DEFENSIVE" r[59] = "WHAT DOES THAT DREAM SUGGEST TO YOU ?" r[60] = "DO YOU DREAM OFTEN ?" r[61] = "WHAT PERSONS APPEAR IN YOUR DREAMS ?" r[62] = "ARE YOU DISTURBED BY YOUR DREAMS ?" r[63] = "HOW DO YOU DO ... PLEASE STATE YOUR PROBLEM" r[64] = "YOU DON'T SEEM QUITE CERTAIN" r[65] = "WHY THE UNCERTAIN TONE ?" r[66] = "CAN'T YOU BE MORE POSITIVE ?" r[67] = "YOU AREN'T SURE ?" r[68] = "DON'T YOU KNOW ?" r[69] = "WHY NO _ ?" r[70] = "DON'T SAY NO, IT'S ALWAYS SO NEGATIVE" r[71] = "WHY NOT ?" r[72] = "ARE YOU SURE ?" r[73] = "WHY NO ?" r[74] = "WHY ARE YOU CONCERNED ABOUT MY _ ?" r[75] = "WHAT ABOUT YOUR OWN _ ?" r[76] = "CAN'T YOU THINK ABOUT A SPECIFIC EXAMPLE ?" r[77] = "WHEN ?" r[78] = "WHAT ARE YOU THINKING OF ?" r[79] = "REALLY, ALWAYS ?" r[80] = "DO YOU REALLY THINK SO ?" r[81] = "BUT YOU ARE NOT SURE YOU _ " r[82] = "DO YOU DOUBT YOU _ ?" r[83] = "IN WHAT WAY ?" r[84] = "WHAT RESEMBLANCE DO YOU SEE ?" r[85] = "WHAT DOES THE SIMILARITY SUGGEST TO YOU ?" r[86] = "WHAT OTHER CONNECTION DO YOU SEE ?" r[87] = "COULD THERE REALLY BE SOME CONNECTIONS ?" r[88] = "HOW ?" r[89] = "YOU SEEM QUITE POSITIVE" r[90] = "ARE YOU SURE ?" r[91] = "I SEE" r[92] = "I UNDERSTAND" r[93] = "WHY DO YOU BRING UP THE TOPIC OF FRIENDS ?" r[94] = "DO YOUR FRIENDS WORRY YOU ?" r[95] = "DO YOUR FRIENDS PICK ON YOU ?" r[96] = "ARE YOU SURE YOU HAVE ANY FRIENDS ?" r[97] = "DO YOU IMPOSE ON YOUR FRIENDS ?" r[98] = "PERHAPS YOUR LOVE FOR FRIENDS WORRIES YOU" r[99] = "DO COMPUTERS WORRY YOU ?" r[100] = "ARE YOU TALKING ABOUT ME IN PARTICULAR ?" r[101] = "ARE YOU FRIGHTENED BY MACHINES ?" r[102] = "WHY DO YOU MENTION COMPUTERS ?" r[103] = "WHAT DO YOU THINK MACHINES HAVE TO DO WITH YOUR PROBLEMS ?" r[104] = "DON'T YOU THINK COMPUTERS CAN HELP PEOPLE ?" r[105] = "WHAT IS IT ABOUT MACHINES THAT WORRIES YOU ?" r[106] = "SAY, DO YOU HAVE ANY PSYCHOLOGICAL PROBLEMS ?" r[107] = "WHAT DOES THAT SUGGEST TO YOU ?" r[108] = "I SEE" r[109] = "IM NOT SURE I UNDERSTAND YOU FULLY" r[110] = "COME COME ELUCIDATE YOUR THOUGHTS" r[111] = "CAN YOU ELABORATE ON THAT ?" r[112] = "THAT IS QUITE INTERESTING" r[113] = "WHY DO YOU HAVE PROBLEMS WITH MONEY ?" r[114] = "DO YOU THINK MONEY IS EVERYTHING ?" r[115] = "ARE YOU SURE THAT MONEY IS THE PROBLEM ?" r[116] = "I THINK WE WANT TO TALK ABOUT YOU, NOT ABOUT ME" r[117] = "WHAT'S ABOUT ME ?" r[118] = "WHY DO YOU ALWAYS BRING UP MY NAME ?" # table for looking up answers that # fit to a certain keyword k["CAN YOU"] = "1 2 3" k["CAN I"] = "4 5" k["YOU ARE"] =\ k["YOURE"] = "6 7 8 9" k["I DONT"] = "10 11 12 13" k["I FEEL"] = "14 15 16" k["WHY DONT YOU"] = "17 18 19" k["WHY CANT I"] = "20 21" k["ARE YOU"] = "22 23 24" k["I CANT"] = "25 26 27" k["I AM"] =\ k["IM "] = "28 29 30 31" k["YOU "] = "32 33 34" k["I WANT"] = "35 36 37 38 39" k["WHAT"] =\ k["HOW"] =\ k["WHO"] =\ k["WHERE"] =\ k["WHEN"] =\ k["WHY"] = "40 41 42 43 44 45 46 47 48" k["NAME"] = "49 50" k["CAUSE"] = "51 52 53 54" k["SORRY"] = "55 56 57 58" k["DREAM"] = "59 60 61 62" k["HELLO"] =\ k["HI "] = "63" k["MAYBE"] = "64 65 66 67 68" k[" NO "] = "69 70 71 72 73" k["YOUR"] = "74 75" k["ALWAYS"] = "76 77 78 79" k["THINK"] = "80 81 82" k["LIKE"] = "83 84 85 86 87 88 89" k["YES"] = "90 91 92" k["FRIEND"] = "93 94 95 96 97 98" k["COMPUTER"] = "99 100 101 102 103 104 105" k["-"] = "106 107 108 109 110 111 112" k["MONEY"] = "113 114 115" k["ELIZA"] = "116 117 118" } PK ! 9�:� examples/network/statist.awknu �[��� function SetUpServer() { TopHeader = "<HTML><title>Statistics with GAWK</title>" TopDoc = "<BODY>\ <h2>Please choose one of the following actions:</h2>\ <UL>\ <LI><A HREF=" MyPrefix "/AboutServer>About this server</A></LI>\ <LI><A HREF=" MyPrefix "/EnterParameters>Enter Parameters</A></LI>\ </UL>" TopFooter = "</BODY></HTML>" GnuPlot = "gnuplot 2>&1" m1=m2=0; v1=v2=1; n1=n2=10 } function HandleGET() { if (MENU[2] == "AboutServer") { Document = "This is a GUI for a statistical computation.\ It compares means and variances of two distributions.\ It is implemented as one GAWK script and uses GNUPLOT." } else if (MENU[2] == "EnterParameters") { Document = "" if ("m1" in GETARG) { # are there parameters to compare? Document = Document "<SCRIPT LANGUAGE=\"JavaScript\">\ setTimeout(\"window.open(\\\"" MyPrefix "/Image" systime()\ "\\\",\\\"dist\\\", \\\"status=no\\\");\", 1000); </SCRIPT>" m1 = GETARG["m1"]; v1 = GETARG["v1"]; n1 = GETARG["n1"] m2 = GETARG["m2"]; v2 = GETARG["v2"]; n2 = GETARG["n2"] t = (m1-m2)/sqrt(v1/n1+v2/n2) df = (v1/n1+v2/n2)*(v1/n1+v2/n2)/((v1/n1)*(v1/n1)/(n1-1) \ + (v2/n2)*(v2/n2) /(n2-1)) if (v1>v2) { f = v1/v2 df1 = n1 - 1 df2 = n2 - 1 } else { f = v2/v1 df1 = n2 - 1 df2 = n1 - 1 } print "pt=ibeta(" df/2 ",0.5," df/(df+t*t) ")" |& GnuPlot print "pF=2.0*ibeta(" df2/2 "," df1/2 "," \ df2/(df2+df1*f) ")" |& GnuPlot print "print pt, pF" |& GnuPlot RS="\n"; GnuPlot |& getline; RS="\r\n" # $1 is pt, $2 is pF print "invsqrt2pi=1.0/sqrt(2.0*pi)" |& GnuPlot print "nd(x)=invsqrt2pi/sd*exp(-0.5*((x-mu)/sd)**2)" |& GnuPlot print "set term png small color" |& GnuPlot #print "set term postscript color" |& GnuPlot #print "set term gif medium size 320,240" |& GnuPlot print "set yrange[-0.3:]" |& GnuPlot print "set label 'p(m1=m2) =" $1 "' at 0,-0.1 left" |& GnuPlot print "set label 'p(v1=v2) =" $2 "' at 0,-0.2 left" |& GnuPlot print "plot mu=" m1 ",sd=" sqrt(v1) ", nd(x) title 'sample 1',\ mu=" m2 ",sd=" sqrt(v2) ", nd(x) title 'sample 2'" |& GnuPlot print "quit" |& GnuPlot GnuPlot |& getline Image while ((GnuPlot |& getline) > 0) Image = Image RS $0 close(GnuPlot) } Document = Document "\ <h3>Do these samples have the same Gaussian distribution?</h3>\ <FORM METHOD=GET> <TABLE BORDER CELLPADDING=5>\ <TR>\ <TD>1. Mean </TD> <TD><input type=text name=m1 value=" m1 " size=8></TD>\ <TD>1. Variance</TD> <TD><input type=text name=v1 value=" v1 " size=8></TD>\ <TD>1. Count </TD> <TD><input type=text name=n1 value=" n1 " size=8></TD>\ </TR><TR>\ <TD>2. Mean </TD> <TD><input type=text name=m2 value=" m2 " size=8></TD>\ <TD>2. Variance</TD> <TD><input type=text name=v2 value=" v2 " size=8></TD>\ <TD>2. Count </TD> <TD><input type=text name=n2 value=" n2 " size=8></TD>\ </TR> <input type=submit value=\"Compute\">\ </TABLE></FORM><BR>" } else if (MENU[2] ~ "Image") { Reason = "OK" ORS "Content-type: image/png" #Reason = "OK" ORS "Content-type: application/x-postscript" #Reason = "OK" ORS "Content-type: image/gif" Header = Footer = "" Document = Image } } PK ! Þ*�� � ! examples/network/fingerclient.awknu �[��� BEGIN { NetService = "/inet/tcp/0/localhost/finger" print "var{name}" |& NetService while ((NetService |& getline) > 0) print $0 close(NetService) } PK ! ��m?? ? examples/network/coreserv.awknu �[��� # CGI Library and core of a web server # # Juergen Kahrs, Juergen.Kahrs@vr-web.de # with Arnold Robbins, arnold@skeeve.com # September 2000 # Global arrays # GETARG --- arguments to CGI GET command # MENU --- menu items (path names) # PARAM --- parameters of form x=y # Optional variable MyHost contains host address # Optional variable MyPort contains port number # Needs TopHeader, TopDoc, TopFooter # Sets MyPrefix, HttpService, Status, Reason BEGIN { if (MyHost == "") { "uname -n" | getline MyHost close("uname -n") } if (MyPort == 0) MyPort = 8080 HttpService = "/inet/tcp/" MyPort "/0/0" MyPrefix = "http://" MyHost ":" MyPort SetUpServer() while ("awk" != "complex") { # header lines are terminated this way RS = ORS = "\r\n" Status = 200 # this means OK Reason = "OK" Header = TopHeader Document = TopDoc Footer = TopFooter if (GETARG["Method"] == "GET") { HandleGET() } else if (GETARG["Method"] == "HEAD") { # not yet implemented } else if (GETARG["Method"] != "") { print "bad method", GETARG["Method"] } Prompt = Header Document Footer print "HTTP/1.0", Status, Reason |& HttpService print "Connection: Close" |& HttpService print "Pragma: no-cache" |& HttpService len = length(Prompt) + length(ORS) print "Content-length:", len |& HttpService print ORS Prompt |& HttpService # ignore all the header lines while ((HttpService |& getline) > 0) continue # stop talking to this client close(HttpService) # wait for new client request HttpService |& getline # do some logging print systime(), strftime(), $0 CGI_setup($1, $2, $3) } } function CGI_setup( method, uri, version, i) { delete GETARG delete MENU delete PARAM GETARG["Method"] = method GETARG["URI"] = uri GETARG["Version"] = version i = index(uri, "?") if (i > 0) { # is there a "?" indicating a CGI request? split(substr(uri, 1, i-1), MENU, "[/:]") split(substr(uri, i+1), PARAM, "&") for (i in PARAM) { PARAM[i] = _CGI_decode(PARAM[i]) j = index(PARAM[i], "=") GETARG[substr(PARAM[i], 1, j-1)] = \ substr(PARAM[i], j+1) } } else { # there is no "?", no need for splitting PARAMs split(uri, MENU, "[/:]") } for (i in MENU) # decode characters in path if (i > 4) # but not those in host name MENU[i] = _CGI_decode(MENU[i]) } function _CGI_decode(str, hexdigs, i, pre, code1, code2, val, result) { hexdigs = "123456789abcdef" i = index(str, "%") if (i == 0) # no work to do return str do { pre = substr(str, 1, i-1) # part before %xx code1 = substr(str, i+1, 1) # first hex digit code2 = substr(str, i+2, 1) # second hex digit str = substr(str, i+3) # rest of string code1 = tolower(code1) code2 = tolower(code2) val = index(hexdigs, code1) * 16 \ + index(hexdigs, code2) result = result pre sprintf("%c", val) i = index(str, "%") } while (i != 0) if (length(str) > 0) result = result str return result } PK ! ܁ examples/network/geturl.awknu �[��� BEGIN { if (ARGC != 2) { print "GETURL - retrieve Web page via HTTP 1.0" print "IN:\n the URL as a command-line parameter" print "PARAM(S):\n -v Proxy=MyProxy" print "OUT:\n the page content on stdout" print " the page header on stderr" print "JK 16.05.1997" print "ADR 13.08.2000" exit } URL = ARGV[1]; ARGV[1] = "" if (Proxy == "") Proxy = "127.0.0.1" if (ProxyPort == 0) ProxyPort = 80 if (Method == "") Method = "GET" HttpService = "/inet/tcp/0/" Proxy "/" ProxyPort ORS = RS = "\r\n\r\n" print Method " " URL " HTTP/1.0" |& HttpService HttpService |& getline Header print Header > "/dev/stderr" while ((HttpService |& getline) > 0) printf "%s", $0 close(HttpService) } PK ! m%�� � examples/network/protbase.resultnu �[��� Sequences producing significant alignments: (bits) Value gb|AC021182.14|AC021182 Homo sapiens chromosome 7 clone RP11-733... 38 0.20 gb|AC021056.12|AC021056 Homo sapiens chromosome 3 clone RP11-115... 38 0.20 emb|AL160278.10|AL160278 Homo sapiens chromosome 9 clone RP11-57... 38 0.20 emb|AL391139.11|AL391139 Homo sapiens chromosome X clone RP11-35... 38 0.20 emb|AL365192.6|AL365192 Homo sapiens chromosome 6 clone RP3-421H... 38 0.20 emb|AL138812.9|AL138812 Homo sapiens chromosome 11 clone RP1-276... 38 0.20 gb|AC073881.3|AC073881 Homo sapiens chromosome 15 clone CTD-2169... 38 0.20 PK ! ��� examples/network/mobag.awknu �[��� BEGIN { if (ARGC != 2) { print "MOBAG - a simple mobile agent" print "CALL:\n gawk -f mobag.awk mobag.awk" print "IN:\n the name of this script as a command-line parameter" print "PARAM:\n -v MyOrigin=myhost.com" print "OUT:\n the result on stdout" print "JK 29.03.1998 01.04.1998" exit } if (MyOrigin == "") { "uname -n" | getline MyOrigin close("uname -n") } } #ReadMySelf /^function / { FUNC = $2 } /^END/ || /^#ReadMySelf/ { FUNC = $1 } FUNC != "" { MOBFUN[FUNC] = MOBFUN[FUNC] RS $0 } (FUNC != "") && (/^}/ || /^#EndOfMySelf/) \ { FUNC = "" } #EndOfMySelf function migrate(Destination, MobCode, Label) { MOBVAR["Label"] = Label MOBVAR["Destination"] = Destination RS = ORS = "\r\n" HttpService = "/inet/tcp/0/" Destination for (i in MOBFUN) MobCode = (MobCode "\n" MOBFUN[i]) MobCode = MobCode "\n\nBEGIN {" for (i in MOBVAR) MobCode = (MobCode "\n MOBVAR[\"" i "\"] = \"" MOBVAR[i] "\"") MobCode = MobCode "\n}\n" print "POST /cgi-bin/PostAgent.sh HTTP/1.0" |& HttpService print "Content-length:", length(MobCode) ORS |& HttpService printf "%s", MobCode |& HttpService while ((HttpService |& getline) > 0) print $0 close(HttpService) } END { if (ARGC != 2) exit # stop when called with wrong parameters if (MyOrigin != "") # is this the originating host? MyInit() # if so, initialize the application else # we are on a host with migrated data MyJob() # so we do our job } function MyInit() { MOBVAR["MyOrigin"] = MyOrigin MOBVAR["Machines"] = "localhost/80 max/80 moritz/80 castor/80" split(MOBVAR["Machines"], Machines) # which host is the first? migrate(Machines[1], "", "") # go to the first host while (("/inet/tcp/8080/0/0" |& getline) > 0) # wait for result print $0 # print result close("/inet/tcp/8080/0/0") } function MyJob() { # forget this host sub(MOBVAR["Destination"], "", MOBVAR["Machines"]) MOBVAR["Result"]=MOBVAR["Result"] SUBSEP SUBSEP MOBVAR["Destination"] ":" while (("who" | getline) > 0) # who is logged in? MOBVAR["Result"] = MOBVAR["Result"] SUBSEP $0 close("who") if (index(MOBVAR["Machines"], "/") > 0) { # any more machines to visit? split(MOBVAR["Machines"], Machines) # which host is next? migrate(Machines[1], "", "") # go there } else { # no more machines gsub(SUBSEP, "\n", MOBVAR["Result"]) # send result to origin print MOBVAR["Result"] |& "/inet/tcp/0/" MOBVAR["MyOrigin"] "/8080" close("/inet/tcp/0/" MOBVAR["MyOrigin"] "/8080") } } PK ! i examples/network/urlchk.awknu �[��� BEGIN { if (ARGC != 2) { print "URLCHK - check if URLs have changed" print "IN:\n the file with URLs as a command-line parameter" print " file contains URL, old length, new length" print "PARAMS:\n -v Proxy=MyProxy -v ProxyPort=8080" print "OUT:\n same as file with URLs" print "JK 02.03.1998" exit } URLfile = ARGV[1]; ARGV[1] = "" if (Proxy != "") Proxy = " -v Proxy=" Proxy if (ProxyPort != "") ProxyPort = " -v ProxyPort=" ProxyPort while ((getline < URLfile) > 0) Length[$1] = $3 + 0 close(URLfile) # now, URLfile is read in and can be updated GetHeader = "gawk " Proxy ProxyPort " -v Method=\"HEAD\" -f geturl.awk " for (i in Length) { GetThisHeader = GetHeader i " 2>&1" while ((GetThisHeader | getline) > 0) if (toupper($0) ~ /CONTENT-LENGTH/) NewLength = $2 + 0 close(GetThisHeader) print i, Length[i], NewLength > URLfile if (Length[i] != NewLength) # report only changed URLs print i, Length[i], NewLength } close(URLfile) } PK ! 0��� � examples/lib/ctime.awknu �[��� # ctime.awk # # awk version of C ctime(3) function function ctime(ts, format) { format = "%a %b %e %H:%M:%S %Z %Y" if (ts == 0) ts = systime() # use current time as default return strftime(format, ts) } PK ! �`��8 8 examples/lib/pwcat.cnu �[��� /* * pwcat.c * * Generate a printable version of the password database. */ /* * Arnold Robbins, arnold@skeeve.com, May 1993 * Public Domain * December 2010, move to ANSI C definition for main(). */ #if HAVE_CONFIG_H #include <config.h> #endif #include <stdio.h> #include <pwd.h> #if defined (STDC_HEADERS) #include <stdlib.h> #endif int main(int argc, char **argv) { struct passwd *p; while ((p = getpwent()) != NULL) #ifdef HAVE_STRUCT_PASSWD_PW_PASSWD printf("%s:%s:%ld:%ld:%s:%s:%s\n", p->pw_name, p->pw_passwd, (long) p->pw_uid, (long) p->pw_gid, p->pw_gecos, p->pw_dir, p->pw_shell); #else printf("%s:*:%ld:%ld:%s:%s\n", p->pw_name, (long) p->pw_uid, (long) p->pw_gid, p->pw_dir, p->pw_shell); #endif endpwent(); return 0; } PK ! U3� � examples/lib/ord.awknu �[��� # ord.awk --- do ord and chr # Global identifiers: # _ord_: numerical values indexed by characters # _ord_init: function to initialize _ord_ # # Arnold Robbins, arnold@skeeve.com, Public Domain # 16 January, 1992 # 20 July, 1992, revised BEGIN { _ord_init() } function _ord_init( low, high, i, t) { low = sprintf("%c", 7) # BEL is ascii 7 if (low == "\a") { # regular ascii low = 0 high = 127 } else if (sprintf("%c", 128 + 7) == "\a") { # ascii, mark parity low = 128 high = 255 } else { # ebcdic(!) low = 0 high = 255 } for (i = low; i <= high; i++) { t = sprintf("%c", i) _ord_[t] = i } } function ord(str, c) { # only first character is of interest c = substr(str, 1, 1) return _ord_[c] } function chr(c) { # force c to be numeric by adding 0 return sprintf("%c", c + 0) } PK ! #f� examples/lib/readfile.awknu �[��� # readfile.awk --- read an entire file at once # # Original idea by Denis Shirokov, cosmogen@gmail.com, April 2013 # function readfile(file, tmp, save_rs) { save_rs = RS RS = "^$" getline tmp < file close(file) RS = save_rs return tmp } PK ! V���� � examples/lib/libintl.awknu �[��� function bindtextdomain(dir, domain) { return dir } function dcgettext(string, domain, category) { return string } function dcngettext(string1, string2, number, domain, category) { return (number == 1 ? string1 : string2) } PK ! �~�b� � examples/lib/round.awknu �[��� # round.awk --- do normal rounding # # Arnold Robbins, arnold@skeeve.com, Public Domain # August, 1996 function round(x, ival, aval, fraction) { ival = int(x) # integer part, int() truncates # see if fractional part if (ival == x) # no fraction return ival # ensure no decimals if (x < 0) { aval = -x # absolute value ival = int(aval) fraction = aval - ival if (fraction >= .5) return int(x) - 1 # -2.5 --> -3 else return int(x) # -2.3 --> -2 } else { fraction = x - ival if (fraction >= .5) return ival + 1 else return ival } } PK ! ��S� examples/lib/ns_passwd.awknu �[��� # ns_passwd.awk --- access password file information # # Arnold Robbins, arnold@skeeve.com, Public Domain # May 1993 # Revised October 2000 # Revised December 2010 # # Reworked for namespaces June 2017, with help from # Andrew J.: Schorr, aschorr@telemetry-investments.com @namespace "passwd" BEGIN { # tailor this to suit your system Awklib = "/usr/local/libexec/awk/" } function Init( oldfs, oldrs, olddol0, pwcat, using_fw, using_fpat) { if (Inited) return oldfs = FS oldrs = RS olddol0 = $0 using_fw = (PROCINFO["FS"] == "FIELDWIDTHS") using_fpat = (PROCINFO["FS"] == "FPAT") FS = ":" RS = "\n" pwcat = Awklib "pwcat" while ((pwcat | getline) > 0) { Byname[$1] = $0 Byuid[$3] = $0 Bycount[++Total] = $0 } close(pwcat) Count = 0 Inited = 1 FS = oldfs if (using_fw) FIELDWIDTHS = FIELDWIDTHS else if (using_fpat) FPAT = FPAT RS = oldrs $0 = olddol0 } function awk::getpwnam(name) { Init() return Byname[name] } function awk::getpwuid(uid) { Init() return Byuid[uid] } function awk::getpwent() { Init() if (Count < Total) return Bycount[++Count] return "" } function awk::endpwent() { Count = 0 } PK ! ���;c c examples/lib/processarray.awknu �[��� function process_array(arr, name, process, do_arrays, i, new_name) { for (i in arr) { new_name = (name "[" i "]") if (isarray(arr[i])) { if (do_arrays) @process(new_name, arr[i]) process_array(arr[i], new_name, process, do_arrays) } else @process(new_name, arr[i]) } } PK ! p��o3 3 examples/lib/cliff_rand.awknu �[��� # cliff_rand.awk --- generate Cliff random numbers # # Arnold Robbins, arnold@skeeve.com, Public Domain # December 2000 BEGIN { _cliff_seed = 0.1 } function cliff_rand() { _cliff_seed = (100 * log(_cliff_seed)) % 1 if (_cliff_seed < 0) _cliff_seed = - _cliff_seed return _cliff_seed } PK ! -=�s� � examples/lib/have_mpfr.awknu �[��� # adequate_math_precision --- return true if we have enough bits # # Andrew Schorr, aschorr@telemetry-investments.com, Public Domain # May 2017 function adequate_math_precision(n) { return (1 != (1+(1/(2^(n-1))))) } PK ! ��M� � examples/lib/walkarray.awknu �[��� function walk_array(arr, name, i) { for (i in arr) { if (isarray(arr[i])) walk_array(arr[i], (name "[" i "]")) else printf("%s[%s] = %s\n", name, i, arr[i]) } } PK ! NҦ� examples/lib/assert.awknu �[��� # assert --- assert that a condition is true. Otherwise, exit. # # Arnold Robbins, arnold@skeeve.com, Public Domain # May, 1993 function assert(condition, string) { if (! condition) { printf("%s:%d: assertion failed: %s\n", FILENAME, FNR, string) > "/dev/stderr" _assert_exit = 1 exit 1 } } END { if (_assert_exit) exit 1 } PK ! ~2� � examples/lib/zerofile.awknu �[��� # zerofile.awk --- library file to process empty input files # # Arnold Robbins, arnold@skeeve.com, Public Domain # June 2003 BEGIN { Argind = 0 } ARGIND > Argind + 1 { for (Argind++; Argind < ARGIND; Argind++) zerofile(ARGV[Argind], Argind) } ARGIND != Argind { Argind = ARGIND } END { if (ARGIND > Argind) for (Argind++; Argind <= ARGIND; Argind++) zerofile(ARGV[Argind], Argind) } PK ! �(�^� � examples/lib/intdiv0.awknu �[��� # intdiv0 --- do integer division # # Arnold Robbins, arnold@skeeve.com, Public Domain # July, 2014 # # Name changed from div() to intdiv() # April, 2015 # # Changed to intdiv0() # April, 2016 function intdiv0(numerator, denominator, result) { split("", result) numerator = int(numerator) denominator = int(denominator) result["quotient"] = int(numerator / denominator) result["remainder"] = int(numerator % denominator) return 0.0 } PK ! ��bN N examples/lib/bits2str.awknu �[��� # bits2str --- turn an integer into readable ones and zeros function bits2str(bits, data, mask) { if (bits == 0) return "0" mask = 1 for (; bits != 0; bits = rshift(bits, 1)) data = (and(bits, mask) ? "1" : "0") data while ((length(data) % 8) != 0) data = "0" data return data } PK ! -s��$ $ examples/lib/inplace.awknu �[��� # inplace --- load and invoke the inplace extension. # # Copyright (C) 2013, 2017, 2019 the Free Software Foundation, Inc. # # This file is part of GAWK, the GNU implementation of the # AWK Programming Language. # # GAWK is free software; you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation; either version 3 of the License, or # (at your option) any later version. # # GAWK is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with this program; if not, write to the Free Software # Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301, USA # # Andrew J. Schorr, aschorr@telemetry-investments.com # January 2013 # # Revised for namespaces # Arnold Robbins, arnold@skeeve.com # July 2017 # June 2019, add backwards compatibility @load "inplace" # Please set inplace::suffix to make a backup copy. For example, you may # want to set inplace::suffix to .bak on the command line or in a BEGIN rule. # Before there were namespaces in gawk, this extension used # INPLACE_SUFFIX as the variable for making backup copies. We allow this # too, so that any code that used the previous version continues to work. # By default, each filename on the command line will be edited inplace. # But you can selectively disable this by adding an inplace::enable=0 argument # prior to files that you do not want to process this way. You can then # reenable it later on the commandline by putting inplace::enable=1 before files # that you wish to be subject to inplace editing. # N.B. We call inplace::end() in the BEGINFILE and END rules so that any # actions in an ENDFILE rule will be redirected as expected. @namespace "inplace" BEGIN { enable = 1 # enabled by default } BEGINFILE { sfx = (suffix ? suffix : awk::INPLACE_SUFFIX) if (filename != "") end(filename, sfx) if (enable) begin(filename = FILENAME, sfx) else filename = "" } END { if (filename != "") end(filename, (suffix ? suffix : awk::INPLACE_SUFFIX)) } PK ! ʸ8� � examples/lib/getopt.awknu �[��� # getopt.awk --- Do C library getopt(3) function in awk # Also supports long options. # # Arnold Robbins, arnold@skeeve.com, Public Domain # # Initial version: March, 1991 # Revised: May, 1993 # Long options added by Greg Minshall, January 2020 # External variables: # Optind -- index in ARGV of first nonoption argument # Optarg -- string value of argument to current option # Opterr -- if nonzero, print our own diagnostic # Optopt -- current option letter # Returns: # -1 at end of options # "?" for unrecognized option # <s> a string representing the current option # Private Data: # _opti -- index in multiflag option, e.g., -abc function getopt(argc, argv, options, longopts, thisopt, i, j) { if (length(options) == 0 && length(longopts) == 0) return -1 # no options given if (argv[Optind] == "--") { # all done Optind++ _opti = 0 return -1 } else if (argv[Optind] !~ /^-[^:[:space:]]/) { _opti = 0 return -1 } if (argv[Optind] !~ /^--/) { # if this is a short option if (_opti == 0) _opti = 2 thisopt = substr(argv[Optind], _opti, 1) Optopt = thisopt i = index(options, thisopt) if (i == 0) { if (Opterr) printf("%c -- invalid option\n", thisopt) > "/dev/stderr" if (_opti >= length(argv[Optind])) { Optind++ _opti = 0 } else _opti++ return "?" } if (substr(options, i + 1, 1) == ":") { # get option argument if (length(substr(argv[Optind], _opti + 1)) > 0) Optarg = substr(argv[Optind], _opti + 1) else Optarg = argv[++Optind] _opti = 0 } else Optarg = "" if (_opti == 0 || _opti >= length(argv[Optind])) { Optind++ _opti = 0 } else _opti++ return thisopt } else { j = index(argv[Optind], "=") if (j > 0) thisopt = substr(argv[Optind], 3, j - 3) else thisopt = substr(argv[Optind], 3) Optopt = thisopt i = match(longopts, "(^|,)" thisopt "($|[,:])") if (i == 0) { if (Opterr) printf("%s -- invalid option\n", thisopt) > "/dev/stderr" Optind++ return "?" } if (substr(longopts, i+1+length(thisopt), 1) == ":") { if (j > 0) Optarg = substr(argv[Optind], j + 1) else Optarg = argv[++Optind] } else Optarg = "" Optind++ return thisopt } } BEGIN { Opterr = 1 # default is to diagnose Optind = 1 # skip ARGV[0] # test program if (_getopt_test) { _myshortopts = "ab:cd" _mylongopts = "longa,longb:,otherc,otherd" while ((_go_c = getopt(ARGC, ARGV, _myshortopts, _mylongopts)) != -1) printf("c = <%s>, Optarg = <%s>\n", _go_c, Optarg) printf("non-option arguments:\n") for (; Optind < ARGC; Optind++) printf("\tARGV[%d] = <%s>\n", Optind, ARGV[Optind]) } } PK ! ]R�m� � examples/lib/rewind.awknu �[��� # rewind.awk --- rewind the current file and start over # # Arnold Robbins, arnold@skeeve.com, Public Domain # September 2000 function rewind( i) { # shift remaining arguments up for (i = ARGC; i > ARGIND; i--) ARGV[i] = ARGV[i-1] # make sure gawk knows to keep going ARGC++ # make current file next to get done ARGV[ARGIND+1] = FILENAME # do it nextfile } PK ! Q04� � examples/lib/groupawk.innu �[��� # group.awk --- functions for dealing with the group file # # Arnold Robbins, arnold@skeeve.com, Public Domain # May 1993 # Revised October 2000 # Revised December 2010 BEGIN { # Change to suit your system _gr_awklib = "/usr/local/libexec/awk/" } function _gr_init( oldfs, oldrs, olddol0, grcat, using_fw, using_fpat, n, a, i) { if (_gr_inited) return oldfs = FS oldrs = RS olddol0 = $0 using_fw = (PROCINFO["FS"] == "FIELDWIDTHS") using_fpat = (PROCINFO["FS"] == "FPAT") FS = ":" RS = "\n" grcat = _gr_awklib "grcat" while ((grcat | getline) > 0) { if ($1 in _gr_byname) _gr_byname[$1] = _gr_byname[$1] "," $4 else _gr_byname[$1] = $0 if ($3 in _gr_bygid) _gr_bygid[$3] = _gr_bygid[$3] "," $4 else _gr_bygid[$3] = $0 n = split($4, a, "[ \t]*,[ \t]*") for (i = 1; i <= n; i++) if (a[i] in _gr_groupsbyuser) _gr_groupsbyuser[a[i]] = _gr_groupsbyuser[a[i]] " " $1 else _gr_groupsbyuser[a[i]] = $1 _gr_bycount[++_gr_count] = $0 } close(grcat) _gr_count = 0 _gr_inited++ FS = oldfs if (using_fw) FIELDWIDTHS = FIELDWIDTHS else if (using_fpat) FPAT = FPAT RS = oldrs $0 = olddol0 } function getgrnam(group) { _gr_init() return _gr_byname[group] } function getgrgid(gid) { _gr_init() return _gr_bygid[gid] } function getgruser(user) { _gr_init() return _gr_groupsbyuser[user] } function getgrent() { _gr_init() if (++_gr_count in _gr_bycount) return _gr_bycount[_gr_count] return "" } function endgrent() { _gr_count = 0 } PK ! ��; ; examples/lib/ftrans.awknu �[��� # ftrans.awk --- handle datafile transitions # # user supplies beginfile() and endfile() functions # # Arnold Robbins, arnold@skeeve.com, Public Domain # November 1992 FNR == 1 { if (_filename_ != "") endfile(_filename_) _filename_ = FILENAME beginfile(FILENAME) } END { endfile(_filename_) } PK ! ����z z examples/lib/join.awknu �[��� # join.awk --- join an array into a string # # Arnold Robbins, arnold@skeeve.com, Public Domain # May 1993 function join(array, start, end, sep, result, i) { if (sep == "") sep = " " else if (sep == SUBSEP) # magic value sep = "" result = array[start] for (i = start + 1; i <= end; i++) result = result sep array[i] return result } PK ! ���6� � examples/lib/readable.awknu �[��� # readable.awk --- library file to skip over unreadable files # # Arnold Robbins, arnold@skeeve.com, Public Domain # October 2000 # December 2010 BEGIN { for (i = 1; i < ARGC; i++) { if (ARGV[i] ~ /^[a-zA-Z_][a-zA-Z0-9_]*=.*/ \ || ARGV[i] == "-" || ARGV[i] == "/dev/stdin") continue # assignment or standard input else if ((getline junk < ARGV[i]) < 0) # unreadable delete ARGV[i] else close(ARGV[i]) } } PK ! �G�[� � examples/lib/passwdawk.innu �[��� # passwd.awk --- access password file information # # Arnold Robbins, arnold@skeeve.com, Public Domain # May 1993 # Revised October 2000 # Revised December 2010 BEGIN { # tailor this to suit your system _pw_awklib = "/usr/local/libexec/awk/" } function _pw_init( oldfs, oldrs, olddol0, pwcat, using_fw, using_fpat) { if (_pw_inited) return oldfs = FS oldrs = RS olddol0 = $0 using_fw = (PROCINFO["FS"] == "FIELDWIDTHS") using_fpat = (PROCINFO["FS"] == "FPAT") FS = ":" RS = "\n" pwcat = _pw_awklib "pwcat" while ((pwcat | getline) > 0) { _pw_byname[$1] = $0 _pw_byuid[$3] = $0 _pw_bycount[++_pw_total] = $0 } close(pwcat) _pw_count = 0 _pw_inited = 1 FS = oldfs if (using_fw) FIELDWIDTHS = FIELDWIDTHS else if (using_fpat) FPAT = FPAT RS = oldrs $0 = olddol0 } function getpwnam(name) { _pw_init() return _pw_byname[name] } function getpwuid(uid) { _pw_init() return _pw_byuid[uid] } function getpwent() { _pw_init() if (_pw_count < _pw_total) return _pw_bycount[++_pw_count] return "" } function endpwent() { _pw_count = 0 } PK ! 8�m� � examples/lib/strtonum.awknu �[��� # mystrtonum --- convert string to number # # Arnold Robbins, arnold@skeeve.com, Public Domain # February, 2004 # Revised June, 2014 function mystrtonum(str, ret, n, i, k, c) { if (str ~ /^0[0-7]*$/) { # octal n = length(str) ret = 0 for (i = 1; i <= n; i++) { c = substr(str, i, 1) # index() returns 0 if c not in string, # includes c == "0" k = index("1234567", c) ret = ret * 8 + k } } else if (str ~ /^0[xX][[:xdigit:]]+$/) { # hexadecimal str = substr(str, 3) # lop off leading 0x n = length(str) ret = 0 for (i = 1; i <= n; i++) { c = substr(str, i, 1) c = tolower(c) # index() returns 0 if c not in string, # includes c == "0" k = index("123456789abcdef", c) ret = ret * 16 + k } } else if (str ~ \ /^[-+]?([0-9]+([.][0-9]*([Ee][0-9]+)?)?|([.][0-9]+([Ee][-+]?[0-9]+)?))$/) { # decimal number, possibly floating point ret = str + 0 } else ret = "NOT-A-NUMBER" return ret } # BEGIN { # gawk test harness # a[1] = "25" # a[2] = ".31" # a[3] = "0123" # a[4] = "0xdeadBEEF" # a[5] = "123.45" # a[6] = "1.e3" # a[7] = "1.32" # a[8] = "1.32E2" # # for (i = 1; i in a; i++) # print a[i], strtonum(a[i]), mystrtonum(a[i]) # } PK ! �;7q� � examples/lib/shellquote.awknu �[��� # shell_quote --- quote an argument for passing to the shell # # Michael Brennan # brennan@madronabluff.com # September 2014 function shell_quote(s, # parameter SINGLE, QSINGLE, i, X, n, ret) # locals { if (s == "") return "\"\"" SINGLE = "\x27" # single quote QSINGLE = "\"\x27\"" n = split(s, X, SINGLE) ret = SINGLE X[1] SINGLE for (i = 2; i <= n; i++) ret = ret QSINGLE SINGLE X[i] SINGLE return ret } PK ! I��� � examples/lib/grcat.cnu �[��� /* * grcat.c * * Generate a printable version of the group database. */ /* * Arnold Robbins, arnold@skeeve.com, May 1993 * Public Domain * December 2010, move to ANSI C definition for main(). */ #if HAVE_CONFIG_H #include <config.h> #endif #if defined (STDC_HEADERS) #include <stdlib.h> #endif #ifndef HAVE_GETGRENT int main() { return 0; } #else #include <stdio.h> #include <grp.h> int main(int argc, char **argv) { struct group *g; int i; while ((g = getgrent()) != NULL) { #ifdef HAVE_STRUCT_GROUP_GR_PASSWD printf("%s:%s:%ld:", g->gr_name, g->gr_passwd, (long) g->gr_gid); #else printf("%s:*:%ld:", g->gr_name, (long) g->gr_gid); #endif for (i = 0; g->gr_mem[i] != NULL; i++) { printf("%s", g->gr_mem[i]); if (g->gr_mem[i+1] != NULL) putchar(','); } putchar('\n'); } endgrent(); return 0; } #endif /* HAVE_GETGRENT */ PK ! �o(\� � examples/lib/noassign.awknu �[��� # noassign.awk --- library file to avoid the need for a # special option that disables command-line assignments # # Arnold Robbins, arnold@skeeve.com, Public Domain # October 1999 function disable_assigns(argc, argv, i) { for (i = 1; i < argc; i++) if (argv[i] ~ /^[a-zA-Z_][a-zA-Z0-9_]*=.*/) argv[i] = ("./" argv[i]) } BEGIN { if (No_command_assign) disable_assigns(ARGC, ARGV) } PK ! W� � examples/lib/quicksort.awknu �[��� # quicksort.awk --- Quicksort algorithm, with user-supplied # comparison function # # Arnold Robbins, arnold@skeeve.com, Public Domain # January 2009 # quicksort --- C.A.R. Hoare's quicksort algorithm. See Wikipedia # or almost any algorithms or computer science text. # # Adapted from K&R-II, page 110 function quicksort(data, left, right, less_than, i, last) { if (left >= right) # do nothing if array contains fewer return # than two elements quicksort_swap(data, left, int((left + right) / 2)) last = left for (i = left + 1; i <= right; i++) if (@less_than(data[i], data[left])) quicksort_swap(data, ++last, i) quicksort_swap(data, left, last) quicksort(data, left, last - 1, less_than) quicksort(data, last + 1, right, less_than) } # quicksort_swap --- helper function for quicksort, should really be inline function quicksort_swap(data, i, j, temp) { temp = data[i] data[i] = data[j] data[j] = temp } PK ! �*�� � examples/lib/gettime.awknu �[��� # getlocaltime.awk --- get the time of day in a usable format # # Arnold Robbins, arnold@skeeve.com, Public Domain, May 1993 # # Returns a string in the format of output of date(1) # Populates the array argument time with individual values: # time["second"] -- seconds (0 - 59) # time["minute"] -- minutes (0 - 59) # time["hour"] -- hours (0 - 23) # time["althour"] -- hours (0 - 12) # time["monthday"] -- day of month (1 - 31) # time["month"] -- month of year (1 - 12) # time["monthname"] -- name of the month # time["shortmonth"] -- short name of the month # time["year"] -- year modulo 100 (0 - 99) # time["fullyear"] -- full year # time["weekday"] -- day of week (Sunday = 0) # time["altweekday"] -- day of week (Monday = 0) # time["dayname"] -- name of weekday # time["shortdayname"] -- short name of weekday # time["yearday"] -- day of year (0 - 365) # time["timezone"] -- abbreviation of timezone name # time["ampm"] -- AM or PM designation # time["weeknum"] -- week number, Sunday first day # time["altweeknum"] -- week number, Monday first day function getlocaltime(time, ret, now, i) { # get time once, avoids unnecessary system calls now = systime() # return date(1)-style output ret = strftime("%a %b %e %H:%M:%S %Z %Y", now) # clear out target array delete time # fill in values, force numeric values to be # numeric by adding 0 time["second"] = strftime("%S", now) + 0 time["minute"] = strftime("%M", now) + 0 time["hour"] = strftime("%H", now) + 0 time["althour"] = strftime("%I", now) + 0 time["monthday"] = strftime("%d", now) + 0 time["month"] = strftime("%m", now) + 0 time["monthname"] = strftime("%B", now) time["shortmonth"] = strftime("%b", now) time["year"] = strftime("%y", now) + 0 time["fullyear"] = strftime("%Y", now) + 0 time["weekday"] = strftime("%w", now) + 0 time["altweekday"] = strftime("%u", now) + 0 time["dayname"] = strftime("%A", now) time["shortdayname"] = strftime("%a", now) time["yearday"] = strftime("%j", now) + 0 time["timezone"] = strftime("%Z", now) time["ampm"] = strftime("%p", now) time["weeknum"] = strftime("%U", now) + 0 time["altweeknum"] = strftime("%W", now) + 0 return ret } PK ! 7��� � examples/prog/wc.awknu �[��� # wc.awk --- count lines, words, characters # # Arnold Robbins, arnold@skeeve.com, Public Domain # May 1993 # Options: # -l only count lines # -w only count words # -c only count characters # # Default is to count lines, words, characters # # Requires getopt() and file transition library functions BEGIN { # let getopt() print a message about # invalid options. we ignore them while ((c = getopt(ARGC, ARGV, "lwc")) != -1) { if (c == "l") do_lines = 1 else if (c == "w") do_words = 1 else if (c == "c") do_chars = 1 } for (i = 1; i < Optind; i++) ARGV[i] = "" # if no options, do all if (! do_lines && ! do_words && ! do_chars) do_lines = do_words = do_chars = 1 print_total = (ARGC - i > 1) } function beginfile(file) { lines = words = chars = 0 fname = FILENAME } function endfile(file) { tlines += lines twords += words tchars += chars if (do_lines) printf "\t%d", lines if (do_words) printf "\t%d", words if (do_chars) printf "\t%d", chars printf "\t%s\n", fname } # do per line { chars += length($0) + 1 # get newline lines++ words += NF } END { if (print_total) { if (do_lines) printf "\t%d", tlines if (do_words) printf "\t%d", twords if (do_chars) printf "\t%d", tchars print "\ttotal" } } PK ! ����� � examples/prog/split.awknu �[��� # split.awk --- do split in awk # # Requires ord() and chr() library functions # # Arnold Robbins, arnold@skeeve.com, Public Domain # May 1993 # Revised slightly, May 2014 # usage: split [-count] [file] [outname] BEGIN { outfile = "x" # default count = 1000 if (ARGC > 4) usage() i = 1 if (i in ARGV && ARGV[i] ~ /^-[[:digit:]]+$/) { count = -ARGV[i] ARGV[i] = "" i++ } # test argv in case reading from stdin instead of file if (i in ARGV) i++ # skip datafile name if (i in ARGV) { outfile = ARGV[i] ARGV[i] = "" } s1 = s2 = "a" out = (outfile s1 s2) } { if (++tcount > count) { close(out) if (s2 == "z") { if (s1 == "z") { printf("split: %s is too large to split\n", FILENAME) > "/dev/stderr" exit 1 } s1 = chr(ord(s1) + 1) s2 = "a" } else s2 = chr(ord(s2) + 1) out = (outfile s1 s2) tcount = 1 } print > out } function usage() { print("usage: split [-num] [file] [outname]") > "/dev/stderr" exit 1 } PK ! &���� � examples/prog/translate.awknu �[��� # translate.awk --- do tr-like stuff # # Arnold Robbins, arnold@skeeve.com, Public Domain # August 1989 # February 2009 - bug fix # Bugs: does not handle things like tr A-Z a-z; it has # to be spelled out. However, if `to' is shorter than `from', # the last character in `to' is used for the rest of `from'. function stranslate(from, to, target, lf, lt, ltarget, t_ar, i, c, result) { lf = length(from) lt = length(to) ltarget = length(target) for (i = 1; i <= lt; i++) t_ar[substr(from, i, 1)] = substr(to, i, 1) if (lt < lf) for (; i <= lf; i++) t_ar[substr(from, i, 1)] = substr(to, lt, 1) for (i = 1; i <= ltarget; i++) { c = substr(target, i, 1) if (c in t_ar) c = t_ar[c] result = result c } return result } function translate(from, to) { return $0 = stranslate(from, to, $0) } # main program BEGIN { if (ARGC < 3) { print "usage: translate from to" > "/dev/stderr" exit } FROM = ARGV[1] TO = ARGV[2] ARGC = 2 ARGV[1] = "-" } { translate(FROM, TO) print } PK ! ���+U U examples/prog/pi.awknu �[��� # pi.awk --- compute the digits of pi # # Katie Wasserman, katie@wass.net # August 2014 BEGIN { digits = 100000 two = 2 * 10 ^ digits pi = two for (m = digits * 4; m > 0; --m) { d = m * 2 + 1 x = pi * m intdiv0(x, d, result) pi = result["quotient"] pi = pi + two } print pi } PK ! ޣ5�u u examples/prog/igawk.shnu �[��� #! /bin/sh # igawk --- like gawk but do @include processing # # Arnold Robbins, arnold@skeeve.com, Public Domain # July 1993 # December 2010, minor edits if [ "$1" = debug ] then set -x shift fi # A literal newline, so that program text is formatted correctly n=' ' # Initialize variables to empty program= opts= while [ $# -ne 0 ] # loop over arguments do case $1 in --) shift break ;; -W) shift # The ${x?'message here'} construct prints a # diagnostic if $x is the null string set -- -W"${@?'missing operand'}" continue ;; -[vF]) opts="$opts $1 '${2?'missing operand'}'" shift ;; -[vF]*) opts="$opts '$1'" ;; -f) program="$program$n@include ${2?'missing operand'}" shift ;; -f*) f=$(expr "$1" : '-f\(.*\)') program="$program$n@include $f" ;; -[W-]file=*) f=$(expr "$1" : '-.file=\(.*\)') program="$program$n@include $f" ;; -[W-]file) program="$program$n@include ${2?'missing operand'}" shift ;; -[W-]source=*) t=$(expr "$1" : '-.source=\(.*\)') program="$program$n$t" ;; -[W-]source) program="$program$n${2?'missing operand'}" shift ;; -[W-]version) echo igawk: version 3.0 1>&2 gawk --version exit 0 ;; -[W-]*) opts="$opts '$1'" ;; *) break ;; esac shift done if [ -z "$program" ] then program=${1?'missing program'} shift fi # At this point, `program' has the program. expand_prog=' function pathto(file, i, t, junk) { if (index(file, "/") != 0) return file if (file == "-") return file for (i = 1; i <= ndirs; i++) { t = (pathlist[i] "/" file) if ((getline junk < t) > 0) { # found it close(t) return t } } return "" } BEGIN { path = ENVIRON["AWKPATH"] ndirs = split(path, pathlist, ":") for (i = 1; i <= ndirs; i++) { if (pathlist[i] == "") pathlist[i] = "." } stackptr = 0 input[stackptr] = ARGV[1] # ARGV[1] is first file for (; stackptr >= 0; stackptr--) { while ((getline < input[stackptr]) > 0) { if (tolower($1) != "@include") { print continue } fpath = pathto($2) if (fpath == "") { printf("igawk: %s:%d: cannot find %s\n", input[stackptr], FNR, $2) > "/dev/stderr" continue } if (! (fpath in processed)) { processed[fpath] = input[stackptr] input[++stackptr] = fpath # push onto stack } else print $2, "included in", input[stackptr], "already included in", processed[fpath] > "/dev/stderr" } close(input[stackptr]) } }' # close quote ends `expand_prog' variable processed_program=$(gawk -- "$expand_prog" /dev/stdin << EOF $program EOF ) eval gawk $opts -- '"$processed_program"' '"$@"' PK ! ��r� � examples/prog/labels.awknu �[��� # labels.awk --- print mailing labels # # Arnold Robbins, arnold@skeeve.com, Public Domain # June 1992 # December 2010, minor edits # Each label is 5 lines of data that may have blank lines. # The label sheets have 2 blank lines at the top and 2 at # the bottom. BEGIN { RS = "" ; MAXLINES = 100 } function printpage( i, j) { if (Nlines <= 0) return printf "\n\n" # header for (i = 1; i <= Nlines; i += 10) { if (i == 21 || i == 61) print "" for (j = 0; j < 5; j++) { if (i + j > MAXLINES) break printf " %-41s %s\n", line[i+j], line[i+j+5] } print "" } printf "\n\n" # footer delete line } # main rule { if (Count >= 20) { printpage() Count = 0 Nlines = 0 } n = split($0, a, "\n") for (i = 1; i <= n; i++) line[++Nlines] = a[i] for (; i <= 5; i++) line[++Nlines] = "" Count++ } END { printpage() } PK ! �3��� � examples/prog/guide.awknu �[��� BEGIN { TEXTDOMAIN = "guide" bindtextdomain(".") # for testing print _"Don't Panic" print _"The Answer Is", 42 print "Pardon me, Zaphod who?" } PK ! D��zA A examples/prog/alarm.awknu �[��� # alarm.awk --- set an alarm # # Requires getlocaltime() library function # # Arnold Robbins, arnold@skeeve.com, Public Domain # May 1993 # Revised December 2010 # usage: alarm time [ "message" [ count [ delay ] ] ] BEGIN { # Initial argument sanity checking usage1 = "usage: alarm time ['message' [count [delay]]]" usage2 = sprintf("\t(%s) time ::= hh:mm", ARGV[1]) if (ARGC < 2) { print usage1 > "/dev/stderr" print usage2 > "/dev/stderr" exit 1 } switch (ARGC) { case 5: delay = ARGV[4] + 0 # fall through case 4: count = ARGV[3] + 0 # fall through case 3: message = ARGV[2] break default: if (ARGV[1] !~ /[[:digit:]]?[[:digit:]]:[[:digit:]]{2}/) { print usage1 > "/dev/stderr" print usage2 > "/dev/stderr" exit 1 } break } # set defaults for once we reach the desired time if (delay == 0) delay = 180 # 3 minutes if (count == 0) count = 5 if (message == "") message = sprintf("\aIt is now %s!\a", ARGV[1]) else if (index(message, "\a") == 0) message = "\a" message "\a" # split up alarm time split(ARGV[1], atime, ":") hour = atime[1] + 0 # force numeric minute = atime[2] + 0 # force numeric # get current broken down time getlocaltime(now) # if time given is 12-hour hours and it's after that # hour, e.g., `alarm 5:30' at 9 a.m. means 5:30 p.m., # then add 12 to real hour if (hour < 12 && now["hour"] > hour) hour += 12 # set target time in seconds since midnight target = (hour * 60 * 60) + (minute * 60) # get current time in seconds since midnight current = (now["hour"] * 60 * 60) + \ (now["minute"] * 60) + now["second"] # how long to sleep for naptime = target - current if (naptime <= 0) { print "alarm: time is in the past!" > "/dev/stderr" exit 1 } # zzzzzz..... go away if interrupted if (system(sprintf("sleep %d", naptime)) != 0) exit 1 # time to notify! command = sprintf("sleep %d", delay) for (i = 1; i <= count; i++) { print message # if sleep command interrupted, go away if (system(command) != 0) break } exit 0 } PK ! �,Y�r r examples/prog/cut.awknu �[��� # cut.awk --- implement cut in awk # # Arnold Robbins, arnold@skeeve.com, Public Domain # May 1993 # Options: # -f list Cut fields # -d c Field delimiter character # -c list Cut characters # # -s Suppress lines without the delimiter # # Requires getopt() and join() library functions function usage() { print("usage: cut [-f list] [-d c] [-s] [files...]") > "/dev/stderr" print("usage: cut [-c list] [files...]") > "/dev/stderr" exit 1 } BEGIN { FS = "\t" # default OFS = FS while ((c = getopt(ARGC, ARGV, "sf:c:d:")) != -1) { if (c == "f") { by_fields = 1 fieldlist = Optarg } else if (c == "c") { by_chars = 1 fieldlist = Optarg OFS = "" } else if (c == "d") { if (length(Optarg) > 1) { printf("cut: using first character of %s" \ " for delimiter\n", Optarg) > "/dev/stderr" Optarg = substr(Optarg, 1, 1) } fs = FS = Optarg OFS = FS if (FS == " ") # defeat awk semantics FS = "[ ]" } else if (c == "s") suppress = 1 else usage() } # Clear out options for (i = 1; i < Optind; i++) ARGV[i] = "" if (by_fields && by_chars) usage() if (by_fields == 0 && by_chars == 0) by_fields = 1 # default if (fieldlist == "") { print "cut: needs list for -c or -f" > "/dev/stderr" exit 1 } if (by_fields) set_fieldlist() else set_charlist() } function set_fieldlist( n, m, i, j, k, f, g) { n = split(fieldlist, f, ",") j = 1 # index in flist for (i = 1; i <= n; i++) { if (index(f[i], "-") != 0) { # a range m = split(f[i], g, "-") if (m != 2 || g[1] >= g[2]) { printf("cut: bad field list: %s\n", f[i]) > "/dev/stderr" exit 1 } for (k = g[1]; k <= g[2]; k++) flist[j++] = k } else flist[j++] = f[i] } nfields = j - 1 } function set_charlist( field, i, j, f, g, n, m, t, filler, last, len) { field = 1 # count total fields n = split(fieldlist, f, ",") j = 1 # index in flist for (i = 1; i <= n; i++) { if (index(f[i], "-") != 0) { # range m = split(f[i], g, "-") if (m != 2 || g[1] >= g[2]) { printf("cut: bad character list: %s\n", f[i]) > "/dev/stderr" exit 1 } len = g[2] - g[1] + 1 if (g[1] > 1) # compute length of filler filler = g[1] - last - 1 else filler = 0 if (filler) t[field++] = filler t[field++] = len # length of field last = g[2] flist[j++] = field - 1 } else { if (f[i] > 1) filler = f[i] - last - 1 else filler = 0 if (filler) t[field++] = filler t[field++] = 1 last = f[i] flist[j++] = field - 1 } } FIELDWIDTHS = join(t, 1, field - 1) nfields = j - 1 } { if (by_fields && suppress && index($0, fs) == 0) next for (i = 1; i <= nfields; i++) { if ($flist[i] != "") { printf "%s", $flist[i] if (i < nfields && $flist[i+1] != "") printf "%s", OFS } } print "" } PK ! !^"�� � examples/prog/egrep.awknu �[��� # egrep.awk --- simulate egrep in awk # # Arnold Robbins, arnold@skeeve.com, Public Domain # May 1993 # Options: # -c count of lines # -s silent - use exit value # -v invert test, success if no match # -i ignore case # -l print filenames only # -e argument is pattern # # Requires getopt and file transition library functions BEGIN { while ((c = getopt(ARGC, ARGV, "ce:svil")) != -1) { if (c == "c") count_only++ else if (c == "s") no_print++ else if (c == "v") invert++ else if (c == "i") IGNORECASE = 1 else if (c == "l") filenames_only++ else if (c == "e") pattern = Optarg else usage() } if (pattern == "") pattern = ARGV[Optind++] for (i = 1; i < Optind; i++) ARGV[i] = "" if (Optind >= ARGC) { ARGV[1] = "-" ARGC = 2 } else if (ARGC - Optind > 1) do_filenames++ # if (IGNORECASE) # pattern = tolower(pattern) } #{ # if (IGNORECASE) # $0 = tolower($0) #} function beginfile(junk) { fcount = 0 } function endfile(file) { if (! no_print && count_only) { if (do_filenames) print file ":" fcount else print fcount } total += fcount } { matches = ($0 ~ pattern) if (invert) matches = ! matches fcount += matches # 1 or 0 if (! matches) next if (! count_only) { if (no_print) nextfile if (filenames_only) { print FILENAME nextfile } if (do_filenames) print FILENAME ":" $0 else print } } END { exit (total == 0) } function usage() { print("Usage: egrep [-csvil] [-e pat] [files ...]") > "/dev/stderr" print("\n\tegrep [-csvil] pat [files ...]") > "/dev/stderr" exit 1 } PK ! {�R;[ [ examples/prog/wordfreq.awknu �[��� # wordfreq.awk --- print list of word frequencies { $0 = tolower($0) # remove case distinctions # remove punctuation gsub(/[^[:alnum:]_[:blank:]]/, "", $0) for (i = 1; i <= NF; i++) freq[$i]++ } END { sort = "sort -k 2nr" for (word in freq) printf "%s\t%d\n", word, freq[word] | sort close(sort) } PK ! -{�ǥ � examples/prog/indirectcall.awknu �[��� # indirectcall.awk --- Demonstrate indirect function calls # # Arnold Robbins, arnold@skeeve.com, Public Domain # January 2009 # average --- return the average of the values in fields $first - $last function average(first, last, sum, i) { sum = 0; for (i = first; i <= last; i++) sum += $i return sum / (last - first + 1) } # sum --- return the sum of the values in fields $first - $last function sum(first, last, ret, i) { ret = 0; for (i = first; i <= last; i++) ret += $i return ret } # For each record, print the class name and the requested statistics { class_name = $1 gsub(/_/, " ", class_name) # Replace _ with spaces # find start for (i = 1; i <= NF; i++) { if ($i == "data:") { start = i + 1 break } } printf("%s:\n", class_name) for (i = 2; $i != "data:"; i++) { the_function = $i printf("\t%s: <%s>\n", $i, @the_function(start, NF) "") } print "" } # num_lt --- do a numeric less than comparison function num_lt(left, right) { return ((left + 0) < (right + 0)) } # num_ge --- do a numeric greater than or equal to comparison function num_ge(left, right) { return ((left + 0) >= (right + 0)) } # do_sort --- sort the data according to `compare' # and return it as a string function do_sort(first, last, compare, data, i, retval) { delete data for (i = 1; first <= last; first++) { data[i] = $first i++ } quicksort(data, 1, i-1, compare) retval = data[1] for (i = 2; i in data; i++) retval = retval " " data[i] return retval } # sort --- sort the data in ascending order and return it as a string function sort(first, last) { return do_sort(first, last, "num_lt") } # rsort --- sort the data in descending order and return it as a string function rsort(first, last) { return do_sort(first, last, "num_ge") } PK ! /���� � examples/prog/testbits.awknu �[��� # bits2str --- turn an integer into readable ones and zeros function bits2str(bits, data, mask) { if (bits == 0) return "0" mask = 1 for (; bits != 0; bits = rshift(bits, 1)) data = (and(bits, mask) ? "1" : "0") data while ((length(data) % 8) != 0) data = "0" data return data } BEGIN { printf "123 = %s\n", bits2str(123) printf "0123 = %s\n", bits2str(0123) printf "0x99 = %s\n", bits2str(0x99) comp = compl(0x99) printf "compl(0x99) = %#x = %s\n", comp, bits2str(comp) shift = lshift(0x99, 2) printf "lshift(0x99, 2) = %#x = %s\n", shift, bits2str(shift) shift = rshift(0x99, 2) printf "rshift(0x99, 2) = %#x = %s\n", shift, bits2str(shift) } PK ! ���^� � examples/prog/id.awknu �[��� # id.awk --- implement id in awk # # Requires user and group library functions # # Arnold Robbins, arnold@skeeve.com, Public Domain # May 1993 # Revised February 1996 # Revised May 2014 # Revised September 2014 # output is: # uid=12(foo) euid=34(bar) gid=3(baz) \ # egid=5(blat) groups=9(nine),2(two),1(one) BEGIN { uid = PROCINFO["uid"] euid = PROCINFO["euid"] gid = PROCINFO["gid"] egid = PROCINFO["egid"] printf("uid=%d", uid) pw = getpwuid(uid) pr_first_field(pw) if (euid != uid) { printf(" euid=%d", euid) pw = getpwuid(euid) pr_first_field(pw) } printf(" gid=%d", gid) pw = getgrgid(gid) pr_first_field(pw) if (egid != gid) { printf(" egid=%d", egid) pw = getgrgid(egid) pr_first_field(pw) } for (i = 1; ("group" i) in PROCINFO; i++) { if (i == 1) printf(" groups=") group = PROCINFO["group" i] printf("%d", group) pw = getgrgid(group) pr_first_field(pw) if (("group" (i+1)) in PROCINFO) printf(",") } print "" } function pr_first_field(str, a) { if (str != "") { split(str, a, ":") printf("(%s)", a[1]) } } PK ! bН� � examples/prog/uniq.awknu �[��� # uniq.awk --- do uniq in awk # # Requires getopt() and join() library functions # # Arnold Robbins, arnold@skeeve.com, Public Domain # May 1993 function usage() { print("Usage: uniq [-udc [-n]] [+n] [ in [ out ]]") > "/dev/stderr" exit 1 } # -c count lines. overrides -d and -u # -d only repeated lines # -u only nonrepeated lines # -n skip n fields # +n skip n characters, skip fields first BEGIN { count = 1 outputfile = "/dev/stdout" opts = "udc0:1:2:3:4:5:6:7:8:9:" while ((c = getopt(ARGC, ARGV, opts)) != -1) { if (c == "u") non_repeated_only++ else if (c == "d") repeated_only++ else if (c == "c") do_count++ else if (index("0123456789", c) != 0) { # getopt() requires args to options # this messes us up for things like -5 if (Optarg ~ /^[[:digit:]]+$/) fcount = (c Optarg) + 0 else { fcount = c + 0 Optind-- } } else usage() } if (ARGV[Optind] ~ /^\+[[:digit:]]+$/) { charcount = substr(ARGV[Optind], 2) + 0 Optind++ } for (i = 1; i < Optind; i++) ARGV[i] = "" if (repeated_only == 0 && non_repeated_only == 0) repeated_only = non_repeated_only = 1 if (ARGC - Optind == 2) { outputfile = ARGV[ARGC - 1] ARGV[ARGC - 1] = "" } } function are_equal( n, m, clast, cline, alast, aline) { if (fcount == 0 && charcount == 0) return (last == $0) if (fcount > 0) { n = split(last, alast) m = split($0, aline) clast = join(alast, fcount+1, n) cline = join(aline, fcount+1, m) } else { clast = last cline = $0 } if (charcount) { clast = substr(clast, charcount + 1) cline = substr(cline, charcount + 1) } return (clast == cline) } NR == 1 { last = $0 next } { equal = are_equal() if (do_count) { # overrides -d and -u if (equal) count++ else { printf("%4d %s\n", count, last) > outputfile last = $0 count = 1 # reset } next } if (equal) count++ else { if ((repeated_only && count > 1) || (non_repeated_only && count == 1)) print last > outputfile last = $0 count = 1 } } END { if (do_count) printf("%4d %s\n", count, last) > outputfile else if ((repeated_only && count > 1) || (non_repeated_only && count == 1)) print last > outputfile close(outputfile) } PK ! �Å� � examples/prog/dupword.awknu �[��� # dupword.awk --- find duplicate words in text # # Arnold Robbins, arnold@skeeve.com, Public Domain # December 1991 # Revised October 2000 { $0 = tolower($0) gsub(/[^[:alnum:][:blank:]]/, " "); $0 = $0 # re-split if (NF == 0) next if ($1 == prev) printf("%s:%d: duplicate %s\n", FILENAME, FNR, $1) for (i = 2; i <= NF; i++) if ($i == $(i-1)) printf("%s:%d: duplicate %s\n", FILENAME, FNR, $i) prev = $NF } PK ! ���z examples/prog/awksed.awknu �[��� # awksed.awk --- do s/foo/bar/g using just print # Thanks to Michael Brennan for the idea # # Arnold Robbins, arnold@skeeve.com, Public Domain # August 1995 function usage() { print "usage: awksed pat repl [files...]" > "/dev/stderr" exit 1 } BEGIN { # validate arguments if (ARGC < 3) usage() RS = ARGV[1] ORS = ARGV[2] # don't use arguments as files ARGV[1] = ARGV[2] = "" } # look ma, no hands! { if (RT == "") printf "%s", $0 else print } PK ! �P�UN N examples/prog/anagram.awknu �[��� # anagram.awk --- An implementation of the anagram-finding algorithm # from Jon Bentley's "Programming Pearls," 2nd edition. # Addison Wesley, 2000, ISBN 0-201-65788-0. # Column 2, Problem C, section 2.8, pp 18-20. # # This program requires gawk 4.0 or newer. # Required gawk-specific features: # - True multidimensional arrays # - split() with "" as separator splits out individual characters # - asort() and asorti() functions # # See https://savannah.gnu.org/projects/gawk. # # Arnold Robbins # arnold@skeeve.com # Public Domain # January, 2011 /'s$/ { next } # Skip possessives { key = word2key($1) # Build signature data[key][$1] = $1 # Store word with signature } # word2key --- split word apart into letters, sort, and join back together function word2key(word, a, i, n, result) { n = split(word, a, "") asort(a) for (i = 1; i <= n; i++) result = result a[i] return result } END { sort = "sort" for (key in data) { # Sort words with same key nwords = asorti(data[key], words) if (nwords == 1) continue # And print. Minor glitch: trailing space at end of each line for (j = 1; j <= nwords; j++) printf("%s ", words[j]) | sort print "" | sort } close(sort) } PK ! �2w: examples/prog/histsort.awknu �[��� # histsort.awk --- compact a shell history file # Thanks to Byron Rakitzis for the general idea # # Arnold Robbins, arnold@skeeve.com, Public Domain # May 1993 { if (data[$0]++ == 0) lines[++count] = $0 } END { for (i = 1; i <= count; i++) print lines[i] } PK ! ���[ [ examples/prog/extract.awknu �[��� # extract.awk --- extract files and run programs from Texinfo files # # Arnold Robbins, arnold@skeeve.com, Public Domain # May 1993 # Revised September 2000 BEGIN { IGNORECASE = 1 } /^@c(omment)?[ \t]+system/ { if (NF < 3) { e = ("extract: " FILENAME ":" FNR) e = (e ": badly formed `system' line") print e > "/dev/stderr" next } $1 = "" $2 = "" stat = system($0) if (stat != 0) { e = ("extract: " FILENAME ":" FNR) e = (e ": warning: system returned " stat) print e > "/dev/stderr" } } /^@c(omment)?[ \t]+file/ { if (NF != 3) { e = ("extract: " FILENAME ":" FNR ": badly formed `file' line") print e > "/dev/stderr" next } if ($3 != curfile) { if (curfile != "") filelist[curfile] = 1 # save to close later curfile = $3 } for (;;) { if ((getline line) <= 0) unexpected_eof() if (line ~ /^@c(omment)?[ \t]+endfile/) break else if (line ~ /^@(end[ \t]+)?group/) continue else if (line ~ /^@c(omment+)?[ \t]+/) continue if (index(line, "@") == 0) { print line > curfile continue } n = split(line, a, "@") # if a[1] == "", means leading @, # don't add one back in. for (i = 2; i <= n; i++) { if (a[i] == "") { # was an @@ a[i] = "@" if (a[i+1] == "") i++ } } print join(a, 1, n, SUBSEP) > curfile } } END { close(curfile) # close the last one for (f in filelist) # close all the rest close(f) } function unexpected_eof() { printf("extract: %s:%d: unexpected EOF or error\n", FILENAME, FNR) > "/dev/stderr" exit 1 } PK ! ���p examples/prog/tee.awknu �[��� # tee.awk --- tee in awk # # Copy standard input to all named output files. # Append content if -a option is supplied. # # Arnold Robbins, arnold@skeeve.com, Public Domain # May 1993 # Revised December 1995 BEGIN { for (i = 1; i < ARGC; i++) copy[i] = ARGV[i] if (ARGV[1] == "-a") { append = 1 delete ARGV[1] delete copy[1] ARGC-- } if (ARGC < 2) { print "usage: tee [-a] file ..." > "/dev/stderr" exit 1 } ARGV[1] = "-" ARGC = 2 } { # moving the if outside the loop makes it run faster if (append) for (i in copy) print >> copy[i] else for (i in copy) print > copy[i] print } END { for (i in copy) close(copy[i]) } PK ! � � � examples/data/class_data1nu �[��� Biology_101 sum average data: 87.0 92.4 78.5 94.9 Chemistry_305 sum average data: 75.2 98.3 94.7 88.2 English_401 sum average data: 100.0 95.6 87.1 93.4 PK ! t���A A examples/data/inventory-shippednu �[��� Jan 13 25 15 115 Feb 15 32 24 226 Mar 15 24 34 228 Apr 31 52 63 420 May 16 34 29 208 Jun 31 42 75 492 Jul 24 34 67 436 Aug 15 34 47 316 Sep 13 55 37 277 Oct 29 54 68 525 Nov 20 87 82 577 Dec 17 35 61 401 Jan 21 36 64 620 Feb 26 58 80 652 Mar 24 75 70 495 Apr 21 70 74 514 PK ! �(� � examples/data/mail-listnu �[��� Amelia 555-5553 amelia.zodiacusque@gmail.com F Anthony 555-3412 anthony.asserturo@hotmail.com A Becky 555-7685 becky.algebrarum@gmail.com A Bill 555-1675 bill.drowning@hotmail.com A Broderick 555-0542 broderick.aliquotiens@yahoo.com R Camilla 555-2912 camilla.infusarum@skynet.be R Fabius 555-1234 fabius.undevicesimus@ucb.edu F Julie 555-6699 julie.perscrutabor@skeeve.com F Martin 555-6480 martin.codicibus@hotmail.com A Samuel 555-3430 samuel.lanceolis@shu.edu A Jean-Paul 555-2127 jeanpaul.campanorum@nyu.edu R PK ! �Ԡ�^ ^ examples/data/guide.ponu �[��� #: guide.awk:4 msgid "Don't Panic" msgstr "" #: guide.awk:5 msgid "The Answer Is" msgstr "" PK ! ���7� � examples/data/class_data2nu �[��� Biology_101 sum average sort rsort data: 87.0 92.4 78.5 94.9 Chemistry_305 sum average sort rsort data: 75.2 98.3 94.7 88.2 English_401 sum average sort rsort data: 100.0 95.6 87.1 93.4 PK ! *+�J examples/data/guide-mellow.ponu �[��� #: guide.awk:4 msgid "Don't Panic" msgstr "Hey man, relax!" #: guide.awk:5 msgid "The Answer Is" msgstr "Like, the scoop is" PK ! ;W� READMEnu �[��� Copyright (C) 2005, 2006, 2007, 2009, 2010, 2011, 2012, 2013, 2014, 2015, 2016, 2017, 2018, 2019, 2020 Free Software Foundation, Inc. Copying and distribution of this file, with or without modification, are permitted in any medium without royalty provided the copyright notice and this notice are preserved. README: This is GNU Awk 5.1.0. It is upwardly compatible with Brian Kernighan's version of Unix awk. It is almost completely compliant with the 2018 POSIX 1003.1 standard for awk. (See the note below about POSIX.) This is a major release. See NEWS and ChangeLog for details. Work to be done is described briefly in the TODO file, which is available only in the 'master' branch in the Git repo. Changes in this version are summarized in the NEWS file. Read the file POSIX.STD for a discussion of issues where the standard says one thing but gawk does something different. To format the documentation with TeX, use at least version 2019-09-20.22 of texinfo.tex. There is a usable copy of texinfo.tex in the doc directory. You must also use at least version 6.7 of texindex and of makeinfo from the texinfo-6.7 distribution. INSTALLATION: Check whether there is a system-specific README file for your system under the `README_d' directory. If there's something there that you should have read and didn't, and you bug me about it, I'm going to yell at you. See the file INSTALL for installation instructions. If you don't have Bison, use the awkgram.c file here. It was generated with Bison, and has no proprietary code in it. (Note that modifying awkgram.y without Bison will be difficult, at best. You might want to get a copy of Bison from the FSF too.) The build mechanics depend upon Bison. Also, gawk doesn't work correctly with some versions of yacc, so just use Bison. If you have an MS-DOS, MS-Windows, or OS/2 system, use the stuff in the `pc' directory. Similarly, there is a separate directory for VMS. Appendix B of ``GAWK: Effective Awk Programming'' discusses configuration in detail. The configuration process is based on GNU Autoconf and Automake. After successful compilation, do `make check' to run the test suite. There should be no output from the `cmp' invocations except in the cases where there are small differences in floating point values, and possibly in the case of strftime. There may be differences based on installed (or not installed) locales and the quality of multibyte character support on your system. Several of the tests ignore errors on purpose; those are not a problem. If there are other differences, please investigate and report the problem. PRINTING THE MANUAL The `doc' directory contains a recent version of texinfo.tex, which will be necessary for printing the manual. Use `make dvi' to get a DVI file from the manual. In the `doc' directory, use `make postscript' to get PostScript versions of the manual, the man page, and the reference card. Use `make pdf' to get PDF versions of the manuals, the man page and the reference card. BUG REPORTS AND FIXES (Un*x systems): Please coordinate changes through Arnold Robbins. In particular, see the section in the manual on reporting bugs. Note that comp.lang.awk is about the worst place to post a gawk bug report. So too is use of a web forum such as Stack Overflow. Please, use the mechanisms outlined in the manual. Email should be sent to bug-gawk@gnu.org. This is a separate mailing list at GNU Central. The advantage to using this address is that bug reports are archived at GNU Central. Arnold Robbins BUG REPORTS AND FIXES, non-Unix systems: MS-DOS with DJGPP: Juan Manuel Guerrero juan.guerrero@gmx.de MS-Windows with MinGW: Eli Zaretskii eliz@gnu.org OS/2: Andreas Buening andreas.buening@nexgo.de VMS: John Malmberg wb8tyw@qsl.net z/OS (OS/390) Contact: Daniel Richard G. skunk@iSKUNK.ORG PK ! ��1C C copyrightnu �[��� Format: http://www.debian.org/doc/packaging-manuals/copyright-format/1.0/ Upstream-Contact: bug-gawk@gnu.org Source: http://ftp.gnu.org/gnu/gawk/ Files-Excluded: doc/*.texi doc/*/*.texi doc/*.info doc/*/*.info doc/gawktexi.in Files: * Copyright: 1986-2014, Free Software Foundation, Inc. License: GPL-3+ Files: debian/* Copyright: 1995-1997, Chris Fearnley <cjf@netaxs.com> 1998-2006, James Troup <james@nocrew.org> 2008-2010, Arthur Loiret <aloiret@debian.org> 2011-2014, Jeroen Schot <schot@a-eskwadraat.nl> License: GPL-3+ License: GPL-3+ This program is free software: you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version. . This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details. . You should have received a copy of the GNU General Public License along with this program. If not, see <http://www.gnu.org/licenses/>. . On Debian systems, the full text of the GNU General Public License version 3 can be found in the file `/usr/share/common-licenses/GPL-3'. PK ! �t � � changelog.Debian.gznu �[��� � �V�r�6}�W�L l5&Û.fݎ���8m�L�Ӿt rE�.��~\�� R�%�q�N <2I`��ݳ��jGq> �0 b7sҺ(��k�u`�p����t��X�`�]sp � L/_}x}�+|xwq~s��+Ԡ���B�h@ %�8�/Zf�͋W /�$J� ����{�C�q��> `�V�\V@!�̕��|�`� �� f� �eX���{�y���Fa;�d���9���Y����`",T�=�M�! ù��G�8ɓ,OG�<J���گ��P��">^��UP�LV�� ��-F �1��K$2M�����-���C�EG�!��Mq�p*�/�]�|ַq��,�� �a�cO ��a�'C� {2 ��_ �*�iY�`Xq[Ý�%�1\� �7�ښ3? eNK�P����Gcx[X�:���<?Uq�m͵q? ��@�-��V�������Vsx�j ?a�PK8���P�$�\�lt�S�c/���p�X6;k^������5R � ��W�L&�g'�t<�=��R{�t�$@�g���JW�����(ϒ|8���4��˹� �����eQ6�����I�Ѐ��ڋ5����7�G�x��w- �JZ�0ْ���f/O ��'�]�4�w6*���&���T W �Y�Uv�"�Hq�$ g�,�lc�Kڼ 3m�� ��4��F�WR�Pқ�3k�P;�a6ʾ�IS'I�)IsIM�O ��$ɳ�a��0������dЭ}� (�EI �y �� Ae0��e@M��}iJ��6s�%�W�� 3�b�N �����3��� �{�L$Fg��?O��r^��_Z7���;�u�̾_6�L�L�&�HN@��! O� ɭq�1z��5�!�c2�<�i��<��ܝ�_`�dpϚ( ��'���E��d���>ҳ \`��!N�!Q� � �We_u�ࢦw�� 6����r{�tl[�����4�gM;פ�e�P[#� H �n�@�(�� t��T ����������5t��S\h�»��~sg!g`m+8� )���!���'��M��� х��D,��g�E�ɍ�0��?^�tC��1�1�O���V�}%)�Ƭ�ڻ\\No.��w��[��ߎ�k� %L�ZY85��h+Vj�l(�N��[a�ɥs7 �\v��EW���ލ�P��Ms4Ǡ��C�ڠB���K���o�!��q PK ! ��)� � AUTHORSnu �[��� Copyright (C) 2006, 2007 Free Software Foundation, Inc. Copying and distribution of this file, with or without modification, are permitted in any medium without royalty provided the copyright notice and this notice are preserved. Gawk was written by Paul Rubin, and finished by Paul Finlason and Richard Stallman. David Trueman and Arnold Robbins took it over, with David doing most of the work to make it compatible with new awk. Circa 1994, Arnold Robbins took over maintenance. PK ! '�R�: : POSIX.STDnu �[��� Copyright (C) 1992, 1995, 1998, 2001, 2006, 2007, 2010, 2011, 2015, 2019 Free Software Foundation, Inc. Copying and distribution of this file, with or without modification, are permitted in any medium without royalty provided the copyright notice and this notice are preserved. -------------------------------------------------------------------------- Sun Apr 21 14:27:19 IDT 2019 ============================ This file documents several things related to the 2008 POSIX standard that I noted after reviewing it. 1. POSIX leaves undefined what happens for something like awk '{ print ; exit }' if=42 /etc/passwd Mawk diagnoses this. Gawk and BWK awk do not. This doesn't seem to be worth the effort to add the code, but at least I'm aware of it. 2. The 2001-2004 standards accidentally required support for hexadecimal floating point constants and for Infinity and Not-A-Number (NaN) values. The 2008 standard now explicitly allows, but does not require, such support. More discussion is provided in the node `POSIX Floating Point Problems' in gawk.texi. 3. String comparison with <, <= etc is supposed to take the locale's collating sequence into account. By default gawk doesn't do this. Rather, gawk will do this only if --posix is in effect. 4. According to POSIX, the function parameters of one function may not have the same name as another function, making this invalid: function foo() { ... } function bar(foo) { ...} Or even: function bar(foo) { ...} function foo() { ... } Gawk enforces this only with --posix. 5. According to POSIX (following the A, K, & W book), when RS = "", then newline is also a separator, "no matter what the value of FS is", implying that this is true even if FS is a regexp. In fact, UNIX awk has never behaved that, way; it adds \n to the list for FS = " " or any other single character, and gawk does too. This is essentially a bug in POSIX. The following things aren't described by POSIX but ought to be: 1. The value of $0 in an END rule 2. The return value of a function that either does return with no value or that falls off the end of the function body. 3. What happens with substr() if start is <= 0, or greater than the length of the string, or if length is <= 0. 4. Whether "next" can be invoked from a function body. PK ! �IS S NEWS.gznu �[��� � �Vko�F�\����� �� I�o��8b;���AQ 'rI]M�1wG�B���;J��F��-��}��� ��n�t� ��9 �'�#�< ��Ls[��rLoloJ�5#��"�#"���I��J�Ӌ^N��(,��J7<��K�.��}�֖��E (q$GǮ�!pI� �Z.u��^rv�����ٕ.q,,��m��ؠ �����g �س[q���/���9��I>�',>L��^��_{{��>"g��@/+v~�)��rѷ��f�hD�B�OX�@ m4��T+Ə�c���D�J��a��-�A@Ň9M��킝�k��nC8x���G/1�� ���Q�IUNa(}z`�w�S%��t�=*?�O��}�{m*K/�#�dL�>�8?.q6�>�V�1M�ɋ���ڔ�j-� ӫ��T ��l_/� �Zi��H�v�a,}��DGd ѣ��J��A�+�~P]NH ���?� ��=��z �W"E�+���T ?��j�y~H� k�}�Y'��2[e8�-�=-6`��t ��ދ�挴�n��ߣM�7�T�[�l-���t�s��9��$� �~ �m�D-���C��-��c]�b�E��ZW}t�0�� ��9�@W�D�EN'����B�@B��O��Cz ��`���Ʈ=)�umd�Y,ݨ�i��> z���SlFJ��@��>��(�V�;Z+9��w��DD�$ފg����E�2��^�[� �?��\M�.KQ���-�76����,k� ����������G��p�����@ ��a�ҩO�yR��8���e�?�a���#�:M}/z��D<��'[">m~�$�Qr����n�L]��~R�z��mC5H�sU�[� �4�@ ��;[;V�1L�����&*K�i�c���+��+Wm,f� ��`�@���T�!���K�D` ��&�[jv\�=vTe ���Q�$.;x c]^��nv6�(�*�v��s�%��K.� �R1 K�J���b�i� c�v��Hq��$߰� {���ON�W��ˉ�|O�I7�A^hv�d�(6��G_��yZ���Ӟ6م�헴�Hf�E�X�&��x�Zt� ��$��,x�5��&CD���*�v�$��<�2�)��$ ��3�I6����� ~!~�����4�H��*�� n�g�on~��䃐}�w�hnJq��x�I���I�v4��.�߬��mƉFNs����%� �-�矯>N��j�ɕr:���jl9�ClZ��T������t�vz}y1�����O���8�е�A��y��q a�Ea��J ����KL�Z0T�D��H��M_`$�'�`�`ߌ��Α�uc�@���?�j1L'��{�A#YR�k�Z4}�n��� g��]/s������|�W1N,�q��Z �1��kϦ��}6V������u��:Tۧj4�m�7(-��P��B������T�8D��q+�2Ay:��.�: ���� �i�ѥ}p�l� Dz_�ə "�2������5�y �Li��}�� ���/�`ܧq�za %�A�[��F6�\�&S�x���&���� �\���zP�qd����ڂcM�� PK ! �� �- - examples/misc/sample.csvnu �[��� PK ! �V�P� � u examples/misc/findpat.awknu �[��� PK ! to&u u y examples/misc/arraymax.awknu �[��� PK ! ��1� 8 examples/misc/test-csv.awknu �[��� PK ! C��� � � examples/misc/simple-csv.awknu �[��� PK ! G���H H ~ examples/misc/addresses.csvnu �[��� PK ! i8� examples/misc/arraymax.datanu �[��� PK ! �h�� � � examples/misc/findpat.datanu �[��� PK ! ��Ò? ? � examples/network/panic.awknu �[��� PK ! �l��� � 1 examples/network/webgrab.awknu �[��� PK ! ^�1� � 8 examples/network/stoxdata.txtnu �[��� PK ! � �N N * examples/network/testserv.awknu �[��� PK ! ~�$�� � � examples/network/hello-serv.awknu �[��� PK ! �9#�� � � examples/network/protbase.awknu �[��� PK ! ���� � ! � examples/network/protbase.requestnu �[��� PK ! FG� � examples/network/PostAgent.shnu �[��� PK ! w�5�_ _ examples/network/maze.awknu �[��� PK ! _9J� � � examples/network/remconf.awknu �[��� PK ! v�>� �& examples/network/stoxpred.awknu �[��� PK ! �����' �' �< examples/network/eliza.awknu �[��� PK ! 9�:� e examples/network/statist.awknu �[��� PK ! Þ*�� � ! �s examples/network/fingerclient.awknu �[��� PK ! ��m?? ? rt examples/network/coreserv.awknu �[��� PK ! ܁ �� examples/network/geturl.awknu �[��� PK ! m%�� � \� examples/network/protbase.resultnu �[��� PK ! ��� .� examples/network/mobag.awknu �[��� PK ! i �� examples/network/urlchk.awknu �[��� PK ! 0��� � �� examples/lib/ctime.awknu �[��� PK ! �`��8 8 )� examples/lib/pwcat.cnu �[��� PK ! U3� � �� examples/lib/ord.awknu �[��� PK ! #f� �� examples/lib/readfile.awknu �[��� PK ! V���� � � examples/lib/libintl.awknu �[��� PK ! �~�b� � � examples/lib/round.awknu �[��� PK ! ��S� �� examples/lib/ns_passwd.awknu �[��� PK ! ���;c c C� examples/lib/processarray.awknu �[��� PK ! p��o3 3 � examples/lib/cliff_rand.awknu �[��� PK ! -=�s� � q� examples/lib/have_mpfr.awknu �[��� PK ! ��M� � �� examples/lib/walkarray.awknu �[��� PK ! NҦ� �� examples/lib/assert.awknu �[��� PK ! ~2� � ~� examples/lib/zerofile.awknu �[��� PK ! �(�^� � o� examples/lib/intdiv0.awknu �[��� PK ! ��bN N �� examples/lib/bits2str.awknu �[��� PK ! -s��$ $ � examples/lib/inplace.awknu �[��� PK ! ʸ8� � �� examples/lib/getopt.awknu �[��� PK ! ]R�m� � �� examples/lib/rewind.awknu �[��� PK ! Q04� � x� examples/lib/groupawk.innu �[��� PK ! ��; ; �� examples/lib/ftrans.awknu �[��� PK ! ����z z -� examples/lib/join.awknu �[��� PK ! ���6� � �� examples/lib/readable.awknu �[��� PK ! �G�[� � � examples/lib/passwdawk.innu �[��� PK ! 8�m� � � examples/lib/strtonum.awknu �[��� PK ! �;7q� � � examples/lib/shellquote.awknu �[��� PK ! I��� � 6� examples/lib/grcat.cnu �[��� PK ! �o(\� � J� examples/lib/noassign.awknu �[��� PK ! W� � 9� examples/lib/quicksort.awknu �[��� PK ! �*�� � �� examples/lib/gettime.awknu �[��� PK ! 7��� � �� examples/prog/wc.awknu �[��� PK ! ����� � � examples/prog/split.awknu �[��� PK ! &���� � � examples/prog/translate.awknu �[��� PK ! ���+U U w examples/prog/pi.awknu �[��� PK ! ޣ5�u u examples/prog/igawk.shnu �[��� PK ! ��r� � � examples/prog/labels.awknu �[��� PK ! �3��� � ! examples/prog/guide.awknu �[��� PK ! D��zA A �! examples/prog/alarm.awknu �[��� PK ! �,Y�r r }+ examples/prog/cut.awknu �[��� PK ! !^"�� � 4: examples/prog/egrep.awknu �[��� PK ! {�R;[ [ B examples/prog/wordfreq.awknu �[��� PK ! -{�ǥ � �C examples/prog/indirectcall.awknu �[��� PK ! /���� � �K examples/prog/testbits.awknu �[��� PK ! ���^� � �N examples/prog/id.awknu �[��� PK ! bН� � T examples/prog/uniq.awknu �[��� PK ! �Å� � �^ examples/prog/dupword.awknu �[��� PK ! ���z a examples/prog/awksed.awknu �[��� PK ! �P�UN N ec examples/prog/anagram.awknu �[��� PK ! �2w: �h examples/prog/histsort.awknu �[��� PK ! ���[ [ aj examples/prog/extract.awknu �[��� PK ! ���p r examples/prog/tee.awknu �[��� PK ! � � � Lu examples/data/class_data1nu �[��� PK ! t���A A .v examples/data/inventory-shippednu �[��� PK ! �(� � �w examples/data/mail-listnu �[��� PK ! �Ԡ�^ ^ �z examples/data/guide.ponu �[��� PK ! ���7� � ={ examples/data/class_data2nu �[��� PK ! *+�J @| examples/data/guide-mellow.ponu �[��� PK ! ;W� } READMEnu �[��� PK ! ��1C C U� copyrightnu �[��� PK ! �t � � ё changelog.Debian.gznu �[��� PK ! ��)� � Ζ AUTHORSnu �[��� PK ! '�R�: : � POSIX.STDnu �[��� PK ! �IS S g� NEWS.gznu �[��� PK Y Y � �
| ver. 1.1 | |
.
| PHP 8.4.22 | Ð“ÐµÐ½ÐµÑ€Ð°Ñ†Ð¸Ñ Ñтраницы: 0.01 |
proxy
|
phpinfo
|
ÐаÑтройка